Labshake search
Citations for Eppendorf :
1 - 50 of 181 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... Fermentation was conducted in approximately 3 L of culture in a bioreactor BioFlo120 (Eppendorf, Hamburg, Germany) at 30°C for 5 days ...
-
bioRxiv - Physiology 2024Quote: ... N = number of sample replicates (groups of n=∼20 tardigrades in a single Eppendorf tube). The majority of samples at -10°C remained unfrozen ...
-
bioRxiv - Bioengineering 2023Quote: ... coli JM108 were grown in a 1.8 L (1.0 L net volume, 0.5 L batch volume) computercontrolled bioreactor (DASGIP parallel bioreactor system, Eppendorf AG, Germany). The bioreactor was equipped with a pH probe and an optical dissolved oxygen probe (Hamilton Bonaduz AG ...
-
bioRxiv - Biophysics 2021Quote: ... The protein samples of N-NTD and N-NTD-SR at 20 µM were prepared in low-binding microtubes (Eppendorf® LoBind) containing 20 mM Tris-HCl buffer (pH 7.5 ...
-
bioRxiv - Microbiology 2020Quote: ... 10 g NaCl) in 2 L baffled shake flasks or a 10 L BioFlo 320 Fermenter (Eppendorf) were used to express the I53-50A or I53-50B.4PT1 proteins grown ...
-
bioRxiv - Immunology 2022Quote: ... 10 g NaCl) grown in 2 L baffled shake flasks or a 10 L BioFlo 320 Fermenter (Eppendorf). Cells were grown at 37°C to an OD600 ∼ 0.8 ...
-
bioRxiv - Immunology 2020Quote: ... 10 g NaCl) grown in 2 L baffled shake flasks or a 10 L BioFlo 320 Fermenter (Eppendorf). Cells were grown at 37°C to an OD600 ~0.8 ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 g/L tetracycline hydrochloride) was grown in batch mode in a 1 L fermenter (DASGIP 1L Bioreactor, Vaudaux Eppendorf) at pH 7.0 (+/-0.2 ...
-
bioRxiv - Microbiology 2020Quote: ... 20 mL of the enrichment was transferred to 5 L NMS medium in a 6-L fermenter controlled with a BioFlo® 120 Bioprocess Control Station (Eppendorf, Hamburg, Germany). Gas stream carrying a relatively low CH4 concentration (0.5% v/v in air ...
-
bioRxiv - Microbiology 2021Quote: ... The n-heptane layer was spectrophotometrically scanned between 230 and 300 nm (BioSpectrometer, Eppendorf). The presence of ergosterol (As281.5 peak ...
-
bioRxiv - Microbiology 2023Quote: Bioreactor cultivations were performed using 1.0 L DASGIP reactors (Eppendorf). Fermentations were performed using YNB with 10 g L−1 (NH4)2SO4 as the nitrogen source ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Synthetic Biology 2020Quote: Bioreactor cultivations were performed in 1.3-L fermenters (BioFlow120, Eppendorf, Germany) with a working volume of 0.5 L mineral salt medium (0.4 L mineral salt medium in fed-batch) ...
-
bioRxiv - Synthetic Biology 2020Quote: Batch fermentations were conducted in 1 L DASGIP bioreactors (Eppendorf, Germany) with an initial volume of 550 mL ...
-
bioRxiv - Plant Biology 2024Quote: ... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
bioRxiv - Cancer Biology 2023Quote: SK-N-BE(2) cells (6000-8000 cells/well) were seeded in 24-well plates (Eppendorf) overnight and prior to treatment with retinoic acid (RA)(10 μM ...
-
bioRxiv - Molecular Biology 2021Quote: Protein expression was scaled-up in a 1.3 L bioreactor (Eppendorf, USA) with 0.5 L initial volume ...
-
bioRxiv - Microbiology 2022Quote: ... viennensis was grown as a continuous culture in 2 L bioreactors (Eppendorf) filled with 1.5 L of fresh water medium (FWM ...
-
bioRxiv - Synthetic Biology 2019Quote: The bioreactor cultivations were carried out in 1.4 L DASGIP reactors (Eppendorf, Germany). Cultivation temperature was controlled at 28 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: Fed-batch fermentations were conducted using a 6.6 L bioreactor (BioFlo 320, Eppendorf) containing 1.7 L R/2 medium (pH 6.8 ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Microbiology 2019Quote: ... swabs were introduced into a DNA/DNase/RNase free 1.5 ml Eppendorf Biopur tube (Cat. N° 0030 121.589, Eppendorf, Germany) containing 500 μl of nuclease free water (Cat ...
-
bioRxiv - Synthetic Biology 2020Quote: ... We then set up a BioFlo120 system with a 5 L bioreactor (Eppendorf, B120110002) and added 3 L of SC-His medium supplemented with 15% glucose after autoclaving ...
-
bioRxiv - Systems Biology 2023Quote: ... Cultivations were carried out in DasGip 1-L stirrer-pro vessels (Eppendorf, Jülich, Germany). The working volume was 500 mL ...
-
bioRxiv - Biophysics 2020Quote: ... The needle was then glued to a 6×4×2 mm Neodyn magnet (QM-06×04×02-N, Magnets4you) and attached to a motorized micromanipulator (PatchMan, Eppendorf). The magnetic needle was lowered until it touched the bottom of a dummy sample dish and raised again so that it was placed above the bottom of the sample with the very tip in focus around 100 μm above the focus of the glass surface.
-
bioRxiv - Immunology 2021Quote: Xela DS2 (passages 120 – 130) and Xela VS2 (passages 125 – 135) (n = 4 independent trials) were seeded in a 6-well plate (Eppendorf) at a cell density of 625,000 cells/well in 1 mL of Xela complete media and allowed to adhere overnight at 26 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... Huh7 cells were grown in 24-well glass bottom plates (170 μm coverglass bottom; Eppendorf, 0030741021; Cellvis, P24-1.5H-N). Cells were either untreated or incubated in 100 μM oleate-BSA complex for 24 hr ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Systems Biology 2021Quote: ... Cells were seeded on poly-L-lysine pretreated (0.001%, 1h) 24-well imaging plates (Eppendorf, Germany) at a density of 1e05 cells/well ...
-
bioRxiv - Microbiology 2023Quote: ... intermedia CBS 141442 was grown in controlled stirred 1-L bioreactor vessels (DASGIP, Eppendorf, Hamburg, Germany) containing 500 mL synthetic defined minimal Verduyn media with 2% Glucose ...
-
bioRxiv - Cell Biology 2023Quote: ... GEMRT was performed in a Bio-Rad PTC-200 Thermal Cycler with semi- skirted 96-Well Plate (Eppendorf P/N 0030 128.605): 53 °C for 45 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Microbiology 2019Quote: ... Loaded microfluidic chambers were centrifuged 3 min at 1000 rcf (Eppendorf centrifuge 5430R) to maximize cell adhesion.
-
bioRxiv - Bioengineering 2022Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 tabletop centrifuge) and resuspended ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
bioRxiv - Bioengineering 2023Quote: Chemostat cultivations were performed at 28°C in DasGip systems with 1 L stirrer -pro vessels (Eppendorf) as previously reported63 ...
-
bioRxiv - Neuroscience 2021Quote: ... GEM-RT was performed in a Bio-Rad PTC-200 Thermal Cycler with semi-skirted 96-Well Plate (Eppendorf, P/N 0030 128.605) following ...
-
High resolution, serial imaging of early mouse and human liver bud morphogenesis in three dimensionsbioRxiv - Developmental Biology 2021Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 table top centrifuge) and resuspended ...
-
bioRxiv - Genomics 2020Quote: ... 3 ml of each bacterial suspension were centrifuged at 6,000 × g (Eppendorf, Westbury, NY) for 2 mins ...
-
bioRxiv - Plant Biology 2020Quote: ... The homogenates were centrifuged at 1,000 g for 3 min (Eppendorf 5430, Hamburg, Germany). The subsequent steps of the RNA extraction were performed on the supernatants according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2019Quote: ... The peptide rOv-GRN-1was concentrated using Centripep with cut-off 3 kDa (Eppendorf) and resuspended in low salt solution ...
-
bioRxiv - Systems Biology 2019Quote: ... and 74.9 °C for 3 minutes in a thermocycler (Mastercycler Pro, Eppendorf, Hamberg, Germany) system as described elsewhere (Jafari et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... for 3 min and then reduced to dryness in a Vacufuge centrifugal concentrator (Eppendorf).
-
bioRxiv - Immunology 2020Quote: ... and fermentation was conducted in a CelliGen 310 Bioreactor with a 7.5 L vessel (Eppendorf, New York, USA), controlled by the Eppendorf Bio Command software ...
-
bioRxiv - Biochemistry 2022Quote: ... 15 L of T-20052 (53) medium was prepared in a 20-liter Bioflow IV bioreactor (Eppendorf/NBS). The seed culture was collected and centrifuged at 3,000 x g for 10 minutes at 25¼;C ...
-
bioRxiv - Bioengineering 2023Quote: Bioreactor fermentations at bench-top level were performed in DasGip 1-L stirrer-pro vessels (Eppendorf, Jülich, Germany) at 30 °C ...