Labshake search
Citations for Eppendorf :
1 - 50 of 1291 citations for N 2 Chloro 5 1 oxo 2 3 pentadecylphenoxy butyl amino phenyl 4 4 dimethyl 3 oxovaleramide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Plant Biology 2024Quote: ... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Biophysics 2020Quote: ... The needle was then glued to a 6×4×2 mm Neodyn magnet (QM-06×04×02-N, Magnets4you) and attached to a motorized micromanipulator (PatchMan, Eppendorf). The magnetic needle was lowered until it touched the bottom of a dummy sample dish and raised again so that it was placed above the bottom of the sample with the very tip in focus around 100 μm above the focus of the glass surface.
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Genomics 2022Quote: ... Beads and proteins were incubated for 3 hours at 4°C (Eppendorf ThermoMixer, 1,300 rpm). Beads were then washed four times with lysis buffer and recovered in 40 µl of laemmli buffer (50 mM Tris-Cl pH 6.8 ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4°C for 5 minutes (Eppendorf centrifuge 5810 R, Rotor S-4-104). Cell pellets were washed with 5 mL D-PBS and centrifugation was repeated ...
-
bioRxiv - Biochemistry 2021Quote: ... cell cultures were collected by centrifugation at 3,300 rpm for 3 min at 4°C (using Eppendorf centrifuge 5810R equipped with the A-4-62 rotor ...
-
bioRxiv - Cell Biology 2023Quote: ... the expelled homogenate was palleted by centrifugation for 3 min (at 300 g at 4°C) (Eppendorf). The pellet was discarded ...
-
bioRxiv - Systems Biology 2024Quote: 20 mL of culture from each of 3 experimental replicates (n = 3) was collected in Protein LoBind tubes (Eppendorf, Hamburg, Germany) by centrifugation at 1650 xg for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Yeast were centrifuged at 3,000 rpm for 3 min in an A-4-62 swing bucket rotor (Eppendorf) and resuspended in 20 ml 1 M sorbitol and incubated at 4 °C overnight (<18 h) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Samples were then extracted for 3 hr at 4°C in a ThermoMixer (Eppendorf US, Enfield, CT, USA), followed by evaporation of the methanol component with a speedvac concentrator (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: Cells (2 ml cultures) were spun down (30 s Eppendorf centrifuge, 14,000 rpm, 4 °C), resuspended in 0.4 ml ice-cold growth medium and added to a screw cap Eppendorf tube containing 1.5 g glass beads (0.1 mm) ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Synthetic Biology 2022Quote: The concentration and quality of the plasmid solutions were determined by diluting 1 ul of plasmid solution in 4 ul of Tris EDTA buffer and loading 3 ul of the diluted solution on a μCuvette G1 (Eppendorf). Optical densities were measured at 260 nm and 280 nm using a BioSpectrophotometer and Fluorimeter (Eppendorf) ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, Eppendorf #A-4-81 rotor) to remove intact cells and debris ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were vigorously vortex-mixed for 3 min and centrifuged at 14,000 rpm for 10 min at 4 °C (Eppendorf 5804 R). The clear supernatant was then transferred to a separate vial ...
-
bioRxiv - Plant Biology 2022Quote: ... annealing at 51 °C for 30 s and extension 72 °C for 30 s for 25 cycles by final extension 72 °C for 3 min and reaction hold at 4 °C in a thermocycler (Gradient thermocycler® Eppendorf). Amplified gene products were sequenced using the Sanger sequencing method ...
-
bioRxiv - Neuroscience 2024Quote: ... They were then resuspended to a concentration of ∼800-3000 nuclei per uL across 3-4 x twin.tec™ 96 Well LoBind PCR Plates (Eppendorf, 0030129512) in NSB ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) to remove intact cells and debris ...
-
bioRxiv - Systems Biology 2021Quote: ... Total volume of 20 mL from each culture was transferred to a 50 mL Falcon® filled with ice and was immediately centrifuged at 3000 rpm for 3 min at 4 °C (Eppendorf centrifuge). Next the supernatant was discarded and the cell pellet was snap frozen into liquid nitrogen and stored at -80 °C ...
-
bioRxiv - Systems Biology 2021Quote: For the extraction of total proteome 10 mL of each culture were transferred into ice-cold 15 mL Falcon® tubes which were centrifuged immediately at 3000 rpm for 3 min at 4 °C (Eppendorf centrifuge). The supernatant from the centrifugation was discarded and the cell pellets were washed once with 1 mL of cold PBS buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... The primers were annealed at 95°C for 4 min followed by 70°C for 3 min in a thermocycler (Eppendorf, Hamburg, Germany). The reaction was allowed to cool slowly to room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are centrifuged (5 min, 5 000 rpm, pre-cooled 4°C, Eppendorf 5430R) and pellets washed two times (500 mM sucrose ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and sonicated in chilled PBS (1 s on ...
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... The homogenate was further incubated on ice for 45 min before centrifugation at 21,000 g and 4°C for 2 x 10 min in an Eppendorf 5424 R benchtop centrifuge (Eppendorf). Protein content of the lysate was determined by BCA assay (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2023Quote: ... and tubes centrifuged at 4 °C for 2 min at 12000 x g in a refrigerated microfuge (Eppendorf 5415R). The upper phase was discarded ...
-
bioRxiv - Biochemistry 2020Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, Eppendorf #A-4-81 rotor) and washed with ice-cold 50 mL Binding buffer composed of 10 mM imidazole (pH 7.4) ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Microbiology 2022Quote: ... The cell suspension was then transferred into 2 mL tubes and centrifuged at 16 000g and 4°C (Eppendorf, Germany) to pellet the cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... About 6 pl dCas9-KRAB mRNA and sgRNA mixes were injected into cytoplasm of zygotes between 2-4 hpi using a Piezo impact-driven micromanipulator (Eppendorf). For all micro-injection experiments ...
-
bioRxiv - Genomics 2024Quote: ... 4 °C with acceleration and deceleration set to 1 (Eppendorf 5910 Ri, Rotor S-4×400).
-
bioRxiv - Microbiology 2024Quote: ... Growth was measured as biomass (OD600) on replicate (n = 4) test tubes using a Biophotometer (Eppendorf). We compared growth of Micrococcus KBS0714 exposed to Rpf (native vs ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Biochemistry 2022Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) and washed with ice-cold 50 mL Binding buffer composed of 10mM imidazole (pH 7.4) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The embryos were deyolked in ice cold Ringer’s solution using a micropipette tip and spun at 100 g for 2 min in a tabletop centrifuge at 4°C (Eppendorf, 5418R). The supernatant was discarded and the embryo bodies were trypsinized using TrypLE Express (Thermo Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... regionalized neural organoids (1-3 organoids per one Eppendorf tube) were transferred into a 1.5 mL Eppendorf tube containing 200 μL of the neural medium ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBS) and pelleted again (500 × g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Neuroscience 2024Quote: ... samples were centrifuged at 4°C for 5 minutes (Eppendorf 5417R Refrigerated Centrifuge) at 16,400 rpm ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were centrifuged at 4°C for 5 minutes (Eppendorf 5417R Refrigerated Centrifuge) at 16,400 rpm ...
-
bioRxiv - Microbiology 2024Quote: ... via centrifugation (5-10 min, 3220 rcf, 4°C, Centrifuge 5810 R; Eppendorf). Then the pellet was resuspended thoroughly in ice-cold 1xPBS and fixed by 1:1 dilution in ice-cold absolute ethanol ...
-
bioRxiv - Cancer Biology 2023Quote: SK-N-BE(2) cells (6000-8000 cells/well) were seeded in 24-well plates (Eppendorf) overnight and prior to treatment with retinoic acid (RA)(10 μM ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Systems Biology 2023Quote: ... and incubated on ice for 1 min before pelleting with a swinging-bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Supernatant was gently removed and ∼50 µl were left behind to increase nuclei recovery ...