Labshake search
Citations for Eppendorf :
1 - 50 of 422 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Dynabeads were separated magnetically and elution buffer containing biotinylated proteins was transferred to a new 1.5 ml LoBind protein tube (Eppendorf). 70 µl of sample was electrophoresed on a NuPAGETM 4-12% Bis-Tris protein gel (Invitrogen) ...
-
bioRxiv - Genomics 2022Quote: ... Beads and proteins were incubated for 3 hours at 4°C (Eppendorf ThermoMixer, 1,300 rpm). Beads were then washed four times with lysis buffer and recovered in 40 µl of laemmli buffer (50 mM Tris-Cl pH 6.8 ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein amounts were assessed using a Pierce BCA protein assay kit and spectrophotometer (Eppendorf BioPhotometer). Equal amounts of protein (15 μg ...
-
bioRxiv - Microbiology 2023Quote: ... The buffer containing the eluted peptides was transferred to a protein LoBind tube (Eppendorf, Hamburg, Germany) containing 20 µl of 10% formic acid (FA) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Vacutip I microinjectors (Eppendorf) were used for the microinjection ...
-
bioRxiv - Biochemistry 2024Quote: ... the pre-weighed mouse tissues were transferred to Protein LoBind 1.5 mL microcentrifuge tubes (Eppendorf) using 500 µL cold sterile DPBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were eluted in 40 μL of 0.2 M glycine pH 3 for 30 min on a ThermoMixer (Eppendorf) at 900 rpm at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... plates were placed on magnetic plates and digestion reaction containing trypsinized peptides was transferred to a protein LoBind Eppendorf tube (Eppendorf, Cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... one milliliter of NS1 recombinant protein (3 mg/ml in 2x PBS) was placed into a 1.5 ml Eppendorf tube (Eppendorf, Germany); and the tube mixed for 66 hours (55°C ...
-
bioRxiv - Microbiology 2023Quote: ... The beads were pelleted (600 x g, 3 min) and the supernatant transferred to a fresh low protein binding tube (Eppendorf). The beads were washed with 1 x 200 µL HPLC-grade water and the washes combined with the original supernatant ...
-
bioRxiv - Developmental Biology 2020Quote: ... micro-injector and associated Femtotips® I (Eppendorf) needles ...
-
bioRxiv - Cell Biology 2021Quote: ... in 25 mM AB) containing 50 µg of lysate protein and shaken overnight in a thermomixer (Eppendorf; 1400 rpm at 37 °C).
-
bioRxiv - Systems Biology 2022Quote: ... each SCN was cut into 3 pieces with a scalpel on a glass slide and transferred to a protein LoBind tube (Eppendorf, Hamburg, Germany) prefilled with 250 µL lysis buffer (100 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Neuroscience 2021Quote: ... the circular DNA fragment containing the shotV104 breakpoint region was amplified using a High Fidelity PCR Kit (Eppendorf and Roche). PCR products were gel-extracted ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 µl of the samples or blanks were pipetted on the 96 well-plate based kit containing calibrators and internal standards using an automated liquid handling station (epMotion 5075, Eppendorf) and subsequently dried under a nitrogen stream using a positive pressure manifold (Waters) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 µl of the samples or blanks were pipetted on the 96 well-plate-based kit containing calibrators and internal standards using an automated liquid handling station (epMotion 5075, Eppendorf) and subsequently dried under a nitrogen stream using a positive pressure manifold (Waters) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein extracts were stored in Protein LoBind tubes (Eppendorf) at −80°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein samples were aliquoted into Protein LoBind tubes (Eppendorf) and polymerised at 30°C quiescently for at least 48 hours ...
-
bioRxiv - Microbiology 2024Quote: Sample were retrotranscribed in cDNA using 1 µL of RNA with 1 µL of Reverse Transcription Master Mix and 3 µL of RNase-free ultrapure water provided with the kit (Standard Biotools, USA) using a thermal cycler (Eppendorf, Germany) with the following cycles ...
-
bioRxiv - Molecular Biology 2024Quote: ... Precleared protein extracts were transferred to Protein Lobind tubes (Eppendorf) and incubated with pre-washed 50 μl of magnetic-streptavidin beads (MyOne C1 ...
-
bioRxiv - Biophysics 2020Quote: ... Tween treated Protein LoBind tubes (Protein LoBind Tubes (1.5 ml, Eppendorf)) were incubated for 4 hours with 2% aqueous Tween solution (Tween20 ...
-
bioRxiv - Biochemistry 2021Quote: hPol I samples were centrifuged (4°C; 15,000 rpm; Eppendorf table top centrifuge) for 5 min ...
-
bioRxiv - Microbiology 2024Quote: ... S7 medium containing HPG was removed (Eppendorf benchtop centrifuge ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Protein LoBind tubes (Eppendorf) and epT.I.P.S ...
-
bioRxiv - Cell Biology 2020Quote: ... protein Lobind tubes (Eppendorf). Elution was repeated and the eluates were pooled ...
-
bioRxiv - Microbiology 2022Quote: ... Protein LoBind tubes (Eppendorf) minimized potential adsorption of protein ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Protein-low binding tubes (Eppendorf) were used to make serial dilutions of BODIPY-cyclopamine.
-
bioRxiv - Physiology 2021Quote: ... in protein LoBind tubes (Eppendorf). Probes were then homogenized at 4°C in Bioruptor Pico sonicator (Diagenode) ...
-
bioRxiv - Neuroscience 2024Quote: ... protein low-binding tubes (Eppendorf) were used ...
-
bioRxiv - Biophysics 2024Quote: ... in Protein LoBind Tubes (Eppendorf). Protein levels were normalized via Bradford assay (Bio-Rad ...
-
bioRxiv - Genomics 2022Quote: ... bead-containing DNA LoBind tubes (Eppendorf Japan, Tokyo, Japan) were replaced twice ...
-
bioRxiv - Genomics 2022Quote: ... bead-containing DNA LoBind tubes (Eppendorf Japan, Tokyo, Japan) were replaced twice ...
-
bioRxiv - Neuroscience 2022Quote: ... Bead-containing samples were incubated in a Thermoshaker (Eppendorf) for four hours at 37 C ...
-
bioRxiv - Cell Biology 2022Quote: ... centrifuged at 4°C and microinjected into prophase I arrested oocytes with a FemtoJet microinjector (Eppendorf). Oocytes were maintained in prophase I for 2 h to express cRNAs before meiosis resumption.
-
bioRxiv - Neuroscience 2020Quote: ... The supernatant with eluted biotinylated proteins was carefully transferred to a low-protein-binding tube (Eppendorf) with a 30g needle and stored at −80°C.
-
bioRxiv - Cell Biology 2020Quote: ... transferred to protein LoBind tubes (Eppendorf), and minced ...
-
bioRxiv - Molecular Biology 2020Quote: ... into protein LoBind tubes (Eppendorf, Germany). Just before encapsulation ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Low protein binding tubes (022431081, Eppendorf) were used for sample preparation ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein LoBind® tubes from Eppendorf; Trypsin (V5111 ...
-
bioRxiv - Biophysics 2022Quote: ... aliquoted into Protein LoBind tubes (Eppendorf), and stored at 4°C (maximum 48 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... antibodies in Protein LoBind tubes (Eppendorf). Thereafter ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Low protein binding tubes (022431081, Eppendorf) were used for sample preparation ...
-
bioRxiv - Microbiology 2020Quote: ... blood samples (approximately 500 μl in Eppendorf tubes containing EDTA) were individually collected from the retroorbital sinus of each mouse ...
-
bioRxiv - Microbiology 2020Quote: ... blood samples (approximately 500 μl in Eppendorf tubes containing EDTA) were individually collected from the retroorbital sinus and plasma was isolated by centrifugation ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant containing vesicles was centrifuged at 60,000 rpm (Eppendorf 5417R centrifuge with a TLA100.3 rotor ...
-
bioRxiv - Cell Biology 2023Quote: ... in a 5% CO2 containing humidified incubator (Eppendorf Galaxy 170S) at 37°C.
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...