Labshake search
Citations for Eppendorf :
251 - 300 of 1036 citations for Mono 2 Ethyl 5 Oxohexyl Phthalate 13C4 99% Dehp Metabolite Vi 100Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Cell Biology 2023Quote: ... in a 5% CO2 containing humidified incubator (Eppendorf Galaxy 170S) at 37°C.
-
bioRxiv - Biophysics 2021Quote: ... We put 500 mL of log phase density (1×106-1×107 cells/mL) cells into 1 mL disposable cuvettes (UVette, 952010051, Eppendorf AG, Hamburg, Germany). We measured the OD600 every hour for 7 hours in each of two cuvettes for each cell line ...
-
bioRxiv - Biochemistry 2022Quote: ... and incubated with Methoxamine hydrochloride (MeOX-HCl, 2%, 40 μl) at 60 °C for 2 hours at 400 rpm in a thermomixer (Eppendorf, USA). After adding N-methyl-N-(trimethylsilyl ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1.5 mL LoBind microtube (Eppendorf), flash frozen ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Cancer Biology 2020Quote: ... suspended in 1 mL TriZol LS reagent and transferred to 1.5 mL Lobind tubes (Eppendorf) along with 0.2 mL chloroform ...
-
bioRxiv - Biochemistry 2019Quote: ... Dilutions (1:2) were performed using EP Motion (Eppendorf) and transferred to cells using the Tecan Freedom Evo ...
-
bioRxiv - Physiology 2020Quote: ... 1% Antibiotic-Antimycotic] in a 5% CO2 incubator (Galaxy 170R, Eppendorf) at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... volume was reduced to 5 μL in a Speedvac concentrator (Eppendorf) and sequencing libraries were prepared using the TruSeq Small RNA Library Prep Kit (Illumina) ...
-
bioRxiv - Biophysics 2023Quote: ... and applied 1,700 V for about 5 ms (Eppendorf Eporator, 4309000027). We quickly washed the cuvette with 500 μl SOC growth medium twice and cells were allowed to recover at 37 °C for 1 hour in a 50 ml conical tube (Corning ...
-
bioRxiv - Bioengineering 2023Quote: ... and centrifuged at 8000 rpm for 5 min (Centrifuge 5430, Eppendorf), where the dissociated monomers or oligomers were separated and mainly located in the supernatant ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 5 min at 37 °C under agitation (Eppendorf, ThermoMixer C). Lobes were pipetted to promote dissociation ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were centrifuged at 272g for 5 minutes (Eppendorf 5810R) at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 ml was aliquoted to each of the duplicate 5.0 mL tubes (Eppendorf Tubes®, Germany) while 50 μL was aliquoted to each of the duplicate 200 μL Polymerase Chain Reaction (PCR ...
-
bioRxiv - Developmental Biology 2020Quote: ... egg-laying chambers (1.5 ml Eppendorf tubes with cut-off tip presenting the head of host pupa plugged in 1000 μL filter pipet tips ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1.5-mL PCR clean (Eppendorf # 022431021) or 96 well plates were used to process the samples.
-
bioRxiv - Neuroscience 2020Quote: 1.5 ml microfuge tubes (Eppendorf, #0030125150)
-
bioRxiv - Biophysics 2020Quote: ... Safe-Lock Tubes (1.5 ml, Eppendorf) were used as Eppendorf tubes ...
-
bioRxiv - Neuroscience 2020Quote: Samples (in 1.5 mL Eppendorf tubes) were kept on dry-ice whilst 150 µL of ice-cold methanol (OptimaT LC-MS ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5 ml DNA LoBind Tubes (Eppendorf) coated in nuclease free water supplemented with RNase Inhibitor and salmon sperm DNA were used to prevent loss of RNA to tube binding.
-
bioRxiv - Cancer Biology 2022Quote: ... in 0.2 mL PCR tubes (Eppendorf). Tissue sections were subjected to whole genome amplification using the Ampli1 WGA Kit (Silicon Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... in 1.5 ml tubes (Eppendorf, CT) for RNA extraction ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... Cycling in a Mastercycler® RealPlex 2 (Eppendorf, Hamburg, Germany) was performed with the following program ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and incubated in a thermal cycler (Eppendorf Realplex 2 Mastercycler) with the following program ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... After centrifugation (500g, 2 min) (Centrifuge 5417C, Eppendorf, VWR, Belgium) to remove large particles ...
-
bioRxiv - Microbiology 2021Quote: ... followed by centrifugation for 2 min at 4500 rpm (Eppendorf Centrifuge 5424 ...
-
bioRxiv - Cell Biology 2023Quote: ... and Eppendorf Femtojet 2 microinjector (local distributors of Eppendorf products). The F2 progeny that inherited and stably expressed the extrachromosomal transgene were UV irradiated to generate integrated lines ...
-
bioRxiv - Biophysics 2020Quote: ... 1 ml of the solution was added to each sample vial (1.5 ml Safe-Lock Tubes, Eppendorf) and rotated for ca ...
-
bioRxiv - Biophysics 2020Quote: ... 1 ml of this solution was added to each sample vial (1.5 ml Safe-Lock Tubes, Eppendorf) and rotated for ca ...
-
bioRxiv - Biophysics 2021Quote: HEK-293T cells were cultured at 37 °C and 5% CO2 (Eppendorf). Cells were plated in 60 mm dishes and transfected with 1 ug of GFP-TAX4 and 3 ug of PEI-MAX per dish ...
-
bioRxiv - Immunology 2019Quote: ... After centrifuging for 5 min at 4000 rpm (Eppendorf Centrifuge 5810 R), all aqueous phase was collected ...
-
bioRxiv - Microbiology 2019Quote: ... The culture was centrifuged at 10,000 g for 5 mins (Eppendorf 5810R) and bacterial pellet was resuspended in DMEM-10 and incubated at 37°C for at least an hour ...
-
bioRxiv - Neuroscience 2020Quote: ... Male heads were incubated for 5 min on a ThermoMixer (Eppendorf 5382000023), and 25 min in a rotating hybridization oven ...
-
Proteome Profiling of Cerebrospinal Fluid Reveals Novel Biomarker Candidates for Parkinson’s DiseasebioRxiv - Systems Biology 2021Quote: ... samples were shaken for 5 min at 2,000 rpm (thermomixer C, Eppendorf). Peptide concentrations were measured optically at 280nm (Nanodrop 2000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... All cell centrifugations were done at 1800 rpm for 5 minutes (Eppendorf). Cells were resuspended in 200 µL of cold PBS and then 1 mL of 4% PFA was added then incubated ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated for 5 min at 70 °C in ThermoMixer® (Eppendorf).
-
bioRxiv - Microbiology 2019Quote: ... 1 ml of each blood meal was transferred to a 1.5 ml Safe Seal microtube (Eppendorf, Hamburg Germany) and stored at −80°C to allow for the determination of ZIKV titers ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... A subset of biopsies were collected into 1 ml aliquots of collection medium (in 1.7 ml Eppendorf tubes) during field work instead of directly into a 15 mL conical tube and transferred to 15 mL tubes containing 10 ml collection medium at the end of the field day ...
-
bioRxiv - Biophysics 2022Quote: ... Aliquots of 1 mL sample were added to 1.5 mL Eppendorf tubes (#0030 120.086, Eppendorf AG, Hamburg, Germany) and placed into a thermomixer (thermomixer comfort ...
-
bioRxiv - Biophysics 2022Quote: ... Aliquots of 1 mL sample were added to 1.5 mL Eppendorf tubes (#0030 120.086, Eppendorf AG, Hamburg, Germany) and placed into a thermomixer (thermomixer comfort ...
-
bioRxiv - Biophysics 2022Quote: ... Aliquots of 1 mL sample were added to 1.5 mL Eppendorf tubes (#0030 120.086, Eppendorf AG, Hamburg, Germany) and placed into a thermomixer (thermomixer comfort ...
-
bioRxiv - Microbiology 2020Quote: ... 1 ml of each blood meal was transferred to a 1.5 ml Safe Seal microtube (Eppendorf, Hamburg Germany) and stored at −80°C ...
-
bioRxiv - Immunology 2022Quote: ... aliquotes of 1 mL sample solution were transferred to 1.5 mL Eppendorf tubes (#0030 120.086, Eppendorf AG, Germany) and placed into a thermomixer (ThermoMixer C ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.3 unit/ml Prime RNase inhibitor (Eppendorf), and 0.9 units/ml MultiScribeTM Reverse Transcriptase (ThermoFisher ...