Labshake search
Citations for Eppendorf :
151 - 200 of 679 citations for L Valine 13C5 95 97%; 15N 96 99%; 2 3 D2 97%+ since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... 40 µL of serum was added to a 96-well extraction plate (Eppendorf twin.tec® 96-well LoBind® plate ...
-
bioRxiv - Biochemistry 2024Quote: ... 40 µL of serum were added to a 96-well extraction plate (Eppendorf twin.tec® 96-well LoBind® plate ...
-
bioRxiv - Synthetic Biology 2020Quote: Bioreactor cultivations were performed in 1.3-L fermenters (BioFlow120, Eppendorf, Germany) with a working volume of 0.5 L mineral salt medium (0.4 L mineral salt medium in fed-batch) ...
-
bioRxiv - Synthetic Biology 2020Quote: Batch fermentations were conducted in 1 L DASGIP bioreactors (Eppendorf, Germany) with an initial volume of 550 mL ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Genomics 2020Quote: ... The released material was collected in a new 96-well PCR plate (Eppendorf, Germany) by aspirating 70μl of the released material.
-
bioRxiv - Genomics 2020Quote: ... ~50 μl of droplets per well was transferred to 96 well plates (Eppendorf #951020362) and sealed with foil (Bio-Rad #181-4040 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 12 individual colonies per sample were transferred to a 96-well PCR plate (Eppendorf), washed with PBS and stored at −80°C ...
-
bioRxiv - Genomics 2020Quote: ... 20-100% of the 1 mL lysate is purified (96 well vs Eppendorf tubes). 96 well format is eluting in 25ul and utilizing 8.6ul in qPCR ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we moved individuals into separate wells of an unskirted 96-well PCR plate (Eppendorf) and removed excess fluid with a sterile pipette ...
-
bioRxiv - Molecular Biology 2019Quote: ... then 22 μl was transferred to a semi-skirted 96-well PCR plate (Eppendorf) and used for droplet generation with an AutoDG droplet generator (BioRad) ...
-
bioRxiv - Genomics 2021Quote: ... Single-coacervates were index-sorted in precooled skirted twin.tec 96-well LoBind Plates (Eppendorf) containing 4 μl of 6 M Guanidine HCl (GuaHCl ...
-
bioRxiv - Cancer Biology 2022Quote: ... topotecan-resistant Y79 (5×103) were plated into 96-well plates (Eppendorf, Sigma Aldrich) and incubated overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... The mixed droplets were transferred to a 96-well twin.tec PCR Plate (Eppendorf, 95579) before sealing the plate with Foil Heat Seal (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... each well of a 96-well cell culture plate (Eppendorf, non-treated, flat bottom) was filled with 190 µL medium (LB or GIM ...
-
bioRxiv - Biochemistry 2024Quote: ... then loaded into an Eppendorf twin-tec PCR 96 well plate (Eppendorf, Hamburg, Germany). A clean ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... This « stock 96 deepwell plate » was then stored at -70°C (CryoCube F750h; Eppendorf).
-
bioRxiv - Molecular Biology 2021Quote: Protein expression was scaled-up in a 1.3 L bioreactor (Eppendorf, USA) with 0.5 L initial volume ...
-
bioRxiv - Genetics 2019Quote: ... Wells with cell content were transferred to a new 96 well PCR plate (Eppendorf, 951020362) in order to utilize multi-channel pipetting for each future step ...
-
bioRxiv - Genetics 2021Quote: ... 40 μL of sample was manually transferred to a 96-well plate (Eppendorf, Hamburg, Germany). Amplification was performed (40 cycles of amplification ...
-
bioRxiv - Biochemistry 2020Quote: ... Deep well 1-mL 96 well plate (Protein LoBind) was purchased from Eppendorf (Hauppauge, NY). Recombinant mouse HEXB protein (His Tag ...
-
bioRxiv - Biochemistry 2022Quote: ... 500 µL fractions were collected using a low protein-binding 96-deep-well plate (Eppendorf). Fractions were aliquoted and stored at -80 °C before adding 3X Blue Loading Buffer (Cell Signaling Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 8.0 before it was transferred to the twin.tec PCR plate 96 (semi-skirted; Eppendorf). Samples were processed with the program and settings previously established for the Automated HUNTER workflow [14] using epBlue Studio (version 40.4.0.38) ...
-
bioRxiv - Genomics 2020Quote: ... 100 cells per gate were collected in 96 well Lo-Bind plates (Eppendorf, Hauppage, NY) containing 5uL of 1XPBS (Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: ... Individual singlet cells were collected in a 96-well Lo-Bind plate (Eppendorf, Hamburg, Germany) containing 5 µL of 100 mM triethylammonium bicarbonate (TEAB ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were sorted using 100 μm nozzle into a 96-well plate (Eppendorf, cat. 951020401) one cell in a well ...
-
bioRxiv - Microbiology 2022Quote: ... Bacteria at 106 CFU/mL were incubated in 96-well microtiter plates (Eppendorf, Hamburg, Germany) containing growth media and various concentrations of gliotoxin in series of two-fold dilutions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2µL nuclei were then distributed to all wells of a 96-well LoBind plate (Eppendorf). To capture hash molecules within each nucleus ...
-
bioRxiv - Developmental Biology 2023Quote: ... were distributed into each well of 12 96-well plates – 4 per background (LoBind Eppendorf). Then 1 μl of uniquely indexed oligo-dT (25 μM ...
-
bioRxiv - Systems Biology 2024Quote: ... cerevisiae cells were prepared, inoculated into deep-well 96-well plates (Eppendorf, 10052143) (Eppendorf, 10052143) containing metal perturbation media and cultivated on 30°C with 1000 rpm shaking (Heidolph Titramax incubator ...
-
bioRxiv - Cell Biology 2023Quote: ... lipid mixtures were transferred into wells of a 96-well Twin tech PCR plate (Eppendorf) using Hamilton syringes ...
-
bioRxiv - Microbiology 2024Quote: ... The bacteria (105 CFU/mL) were incubated in a 96-well microtiter plate (Eppendorf, Germany) containing Mueller–Hinton II broth (MHB ...
-
bioRxiv - Synthetic Biology 2019Quote: The bioreactor cultivations were carried out in 1.4 L DASGIP reactors (Eppendorf, Germany). Cultivation temperature was controlled at 28 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: Fed-batch fermentations were conducted using a 6.6 L bioreactor (BioFlo 320, Eppendorf) containing 1.7 L R/2 medium (pH 6.8 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and InjectMan NI 2 (Eppendorf). Cas9 protein (500 ng/μL) ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Genomics 2021Quote: ... The cells were collected in ~3uL and transferred to a lobind 96 well PCR plate (Eppendorf), immediately placed on dry ice ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The prepared droplets were transferred to corresponding wells of a 96-well PCR plate (Eppendorf, Germany). The PCR plate was subsequently heat-sealed with pierceable foil using a PX1™ PCR plate sealer (Bio-Rad ...
-
bioRxiv - Cell Biology 2019Quote: ... All liquid handling steps were performed in 96-well plate format using Epmotion 5075 TMX (Eppendorf) and Liquidator96 (Rainin) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... using random hexamers (Eurofins Genomics) in a 96-well PCR machine (MasterCycler, Eppendorf, Mississauga, ON, Canada).
-
bioRxiv - Molecular Biology 2020Quote: ... the droplets obtained from each sample were transferred to a 96-well PCR plate (Eppendorf, Germany). The amplification was carried out using T100TM Thermal Cycler (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... 1xPBS) on 96 well plates for two hours and incubated on a MixMate thermomixer (Eppendorf, USA) at 25 °C under constant shaking (300 rpm) ...
-
bioRxiv - Neuroscience 2023Quote: ... 100 microglia were sorted and immediately collected in one well of a 96-well plate (Eppendorf) filled with 5 µl cold lysis buffer from the NEBNext® Single Cell/Low Input cDNA Synthesis & Amplification Module (New England Bio Labs ...
-
bioRxiv - Biochemistry 2023Quote: ... in 0.3% acetic acid was added to a 96-well plate (CAT# 0030128664, Eppendorf, Hamburg, Germany), sealed with plate seal (CAT# 5010-21951 ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR programs were run on an Applied Biosystems 96-Well Thermal Cycler (Eppendorf AG, Hamburg, Germany) for the DNase treatment and reverse transcription reaction ...
-
bioRxiv - Immunology 2024Quote: ... individual or small pools of cells were sorted in 96-well plates (Eppendorf twin.tec PCR LoBind) in 50µl of lysis buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were run in a 96 well plate format on a Mastercycler epgradient S thermocycler (Eppendorf). Primer pairs to quanitify to IRX3 mRNA were 5’-CTCACAGACTGGTCTCAGCG-3’ (forward) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... We then set up a BioFlo120 system with a 5 L bioreactor (Eppendorf, B120110002) and added 3 L of SC-His medium supplemented with 15% glucose after autoclaving ...
-
bioRxiv - Systems Biology 2023Quote: ... Cultivations were carried out in DasGip 1-L stirrer-pro vessels (Eppendorf, Jülich, Germany). The working volume was 500 mL ...
-
bioRxiv - Cell Biology 2022Quote: ... Log phase yeast were transferred to concanavalin A-treated 96-well glass bottom plates (Eppendorf, Hamburg, Germany) and imaged using a DMi8 microscope (Leica Microsystems ...