Labshake search
Citations for Eppendorf :
1 - 50 of 704 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
bioRxiv - Biochemistry 2021Quote: ... β-chitin aliquots from the culture flasks were transferred to 2 mL Safe-Lock Eppendorf tubes (Eppendorf, Hamburg, Germany) and boiled directly for 5 min in 30 µL NuPAGE LDS sample buffer and NuPAGE sample reducing agent (Invitrogen™ ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 3.5Lμl 2-β mercaptoethanol (#444203, MilliporeSigma) was added directly to the beads and incubated with mixing on a ThermoMixer (Eppendorf) for 10□min at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... supplemented with 3.5 μL 2-β mercaptoethanol was added directly to the beads and incubated with mixing on a ThermoMixer (Eppendorf) for 10 minutes at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... supplemented with 3.5Lμl 2-β mercaptoethanol (#444203, MilliporeSigma) was added directly to the beads and incubated with mixing on a ThermoMixer (Eppendorf) for 10Lmin at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were eluted in 40 μL of 0.2 M glycine pH 3 for 30 min on a ThermoMixer (Eppendorf) at 900 rpm at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and sonicated in chilled PBS (1 s on ...
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... centrifuged at 12000 rpm (13523 ×g) for 2 min (Eppendorf, 5424 R),transferred to filter-containing centrifuge tubes (Ultrafree-MC-VV ...
-
bioRxiv - Microbiology 2024Quote: ... and centrifuged for 2 minutes at 2204 x g (Eppendorf, 5430-R). After removing the adhesive film ...
-
bioRxiv - Microbiology 2023Quote: ... the fermentation broth was centrifuged at 9000 r/min for 3 min (Eppendorf Centrifuge 5424, Germany), and the resultant pellet was collected for bacterial DNA extraction using the FastDNA® Spin Kit for Soil (MP Biomedicals ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 g NaCl) in 2 L baffled shake flasks or a 10 L BioFlo 320 Fermenter (Eppendorf) were used to express the I53-50A or I53-50B.4PT1 proteins grown ...
-
bioRxiv - Immunology 2024Quote: ... 10 g NaCl) in 2 L baffled shake flasks or a 10 L BioFlo 320 Fermenter (Eppendorf), were transformed with a I53-50B.4PT1-encoding plasmid ...
-
bioRxiv - Microbiology 2022Quote: ... viennensis was grown as a continuous culture in 2 L bioreactors (Eppendorf) filled with 1.5 L of fresh water medium (FWM ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The grown cultures were pelleted using a centrifuge (Eppendorf, 5804 R; 5000 RPM, 22°C, 3 min), washed and re-suspended in 0.8% sterile NaCl solution ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Plant Biology 2022Quote: ... Fermentation was conducted in approximately 3 L of culture in a bioreactor BioFlo120 (Eppendorf, Hamburg, Germany) at 30°C for 5 days ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Immunology 2022Quote: ... 10 g NaCl) grown in 2 L baffled shake flasks or a 10 L BioFlo 320 Fermenter (Eppendorf). Cells were grown at 37°C to an OD600 ∼ 0.8 ...
-
bioRxiv - Immunology 2020Quote: ... 10 g NaCl) grown in 2 L baffled shake flasks or a 10 L BioFlo 320 Fermenter (Eppendorf). Cells were grown at 37°C to an OD600 ~0.8 ...
-
bioRxiv - Molecular Biology 2021Quote: ... complete amino acid supplementation) overnight in 96-well flat bottom plates (Eppendorf), diluted into fresh medium with a dilution factor of 200 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 0.003% Tricaine (ethyl-3-aminobenzoate-methanesulfonate) for 60 min at 31 °C in a Thermomixer (Eppendorf, Thermomixer R) set to 100 rpm ...
-
bioRxiv - Cell Biology 2024Quote: ... for RERE (30 cycles) and β-ACTIN (20 cycles) using a thermocycler (Eppendorf) and then separated on an agarose gel (Alkali Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Microbiology 2020Quote: ... nine 1 mL aliquots were centrifuged for 2 min at 2500 rcf (Eppendorf, Centrifuge 5424 R) and the MOPS-based supernatant removed ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were vigorously vortex-mixed for 3 min and centrifuged at 14,000 rpm for 10 min at 4 °C (Eppendorf 5804 R). The clear supernatant was then transferred to a separate vial ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Cell Biology 2020Quote: ... The homogenate was further incubated on ice for 45 min before centrifugation at 21,000 g and 4°C for 2 x 10 min in an Eppendorf 5424 R benchtop centrifuge (Eppendorf). Protein content of the lysate was determined by BCA assay (Thermo Fisher) ...
-
bioRxiv - Microbiology 2024Quote: ... the hydrolysis of different β-lactam antibiotics was monitored spectrophotometrically using a BioSpectrometer kinetic (Eppendorf Inc., Germany). The reactions were conducted by incubating the PBPs with the β-lactam substrates at 30 °C in 10 mM phosphate buffer (pH 7.4 ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Systems Biology 2024Quote: 20 mL of culture from each of 3 experimental replicates (n = 3) was collected in Protein LoBind tubes (Eppendorf, Hamburg, Germany) by centrifugation at 1650 xg for 10 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... peptides were eluted in 40 μl of 80% acetonitrile in 0.1% TFA and concentrated down to 2 μl by vacuum centrifugation (Concentrator 5301, Eppendorf). The peptide sample was then prepared for LC-MS/MS analysis by diluting it to 5 μl by 0.1% TFA ...
-
bioRxiv - Microbiology 2024Quote: ... spore suspensions (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) were directly exposed to either of the two temperatures for two weeks ...
-
bioRxiv - Cell Biology 2020Quote: ... The whole lane was excised from the gel and future cut into approximate 3 x 1 x 2 mm3 slices (L x W x H) and each slice were placed into a separate LoBind tubes (Eppendorf) for destaining ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and InjectMan NI 2 (Eppendorf). Cas9 protein (500 ng/μL) ...
-
bioRxiv - Biophysics 2024Quote: ... a 2 mL tube (Eppendorf), containing 1 mL of a 2% BSA + 0.2% FBS in PBS solution ...
-
bioRxiv - Biophysics 2024Quote: ... A 2 mL tube (Eppendorf), containing a suspended cells at a 5 million per mL concentration in a 2% BSA + 0.2% FBS in PBS solution ...
-
bioRxiv - Biophysics 2023Quote: ... were coated with Expi293 cell produced RS2 at 4 µg/mL concentration in 1x PBS (60 µl/well) and incubated for 2 h at 25 °C under gentle shaking condition (300 rpm) on a thermomixer (Eppendorf, USA) and then plate was transferred to 4 °C cold room for overnight ...
-
bioRxiv - Bioengineering 2024Quote: ... The 12 initial cultivations were executed in a DASGIP© Parallel Bioreactor System (max. working volume 2 L; Eppendorf, Hamburg, Germany) as described in [51] ...
-
bioRxiv - Biochemistry 2022Quote: ... samples were prepared in 96 well microtiter plates by adding 12.5 μL reaction supernatant to 50 μL acetonitrile with 1% v/v trifluoroacetic acid (TFA) followed by centrifugation (2,204 g, 30 min; A-2-DWP rotor, Eppendorf AG, Hamburg, Germany) and transferring of 50 μL centrifugation supernatant into 150 μL MilliQ H2O ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Neuroscience 2024Quote: ... regionalized neural organoids (1-3 organoids per one Eppendorf tube) were transferred into a 1.5 mL Eppendorf tube containing 200 μL of the neural medium ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 mM β-glycerol phosphate and 2.5 mM Na2H2P2O7).) and cells scraped and transferred into Protein Lo-bind tubes (Eppendorf). Samples were sonicated for 10 cycles (30s on & 40s off ...
-
bioRxiv - Biochemistry 2024Quote: ... four times (1600 μL) ice-cold 80% acetone was added to 400 μL of urine in 2 ml protein Lo-Bind tubes (Eppendorf, Hamburg, Germany). After incubating at −20 °C for 1hr ...
-
bioRxiv - Cancer Biology 2024Quote: ... on a RealPlex 2 Thermocycler (Eppendorf).