Labshake search
Citations for Eppendorf :
1 - 50 of 448 citations for Fc Receptor Like Protein 3 FCRL3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... antibodies in Protein LoBind tubes (Eppendorf). Thereafter ...
-
bioRxiv - Microbiology 2024Quote: ... Solid samples like soil and composting material (roughly one fourth of an Eppendorf tube) were resuspended in 1ml of PAS buffer (120 mg NaCl ...
-
bioRxiv - Systems Biology 2024Quote: 20 mL of culture from each of 3 experimental replicates (n = 3) was collected in Protein LoBind tubes (Eppendorf, Hamburg, Germany) by centrifugation at 1650 xg for 10 min ...
-
bioRxiv - Genomics 2022Quote: ... Beads and proteins were incubated for 3 hours at 4°C (Eppendorf ThermoMixer, 1,300 rpm). Beads were then washed four times with lysis buffer and recovered in 40 µl of laemmli buffer (50 mM Tris-Cl pH 6.8 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-ZC3H11A or anti-THOC2 antibodies in Protein LoBind 2-ml tubes (Eppendorf). Thereafter ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were eluted in 40 μL of 0.2 M glycine pH 3 for 30 min on a ThermoMixer (Eppendorf) at 900 rpm at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... one milliliter of NS1 recombinant protein (3 mg/ml in 2x PBS) was placed into a 1.5 ml Eppendorf tube (Eppendorf, Germany); and the tube mixed for 66 hours (55°C ...
-
bioRxiv - Microbiology 2023Quote: ... The beads were pelleted (600 x g, 3 min) and the supernatant transferred to a fresh low protein binding tube (Eppendorf). The beads were washed with 1 x 200 µL HPLC-grade water and the washes combined with the original supernatant ...
-
bioRxiv - Systems Biology 2022Quote: ... each SCN was cut into 3 pieces with a scalpel on a glass slide and transferred to a protein LoBind tube (Eppendorf, Hamburg, Germany) prefilled with 250 µL lysis buffer (100 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2020Quote: ... was added to a reagent-to-antibody molar ratio 10:1 in Protein LoBind tubes (Eppendorf, Hamburg, Germany), and the solutions were incubated for 1 h at room temperature under constant shaking at 500 rpm ...
-
bioRxiv - Neuroscience 2024Quote: ... The adjacent 3-5 sections of 100 micron tissue sections were collected in a pre-chilled 2mL microcentrifuge tube (Eppendorf Protein LoBind Tube, Cat #22431102) to total a volume of approximately 40 mg for each donor ...
-
bioRxiv - Biochemistry 2024Quote: ... clean oocytes collected from the above steps were transferred into 3 μL of master mix at the bottom of 384-well plates (Eppendorf, Protein LoBind, order No. 0030624300) or autosampler vials (Waters ...
-
bioRxiv - Immunology 2023Quote: ... Cells were sorted into DMEM + 5% FCS in DNA Lo-Bind tubes (Eppendorf, cat # 022431021). After spinning down for 5 min at 500g in a refrigerated centrifuge at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Cells were sorted into RPMI + 5% FCS in DNA Lo-Bind tubes (Eppendorf, cat # 022431021). After spinning down for 5 min at 500g in a refrigerated centrifuge at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein extracts were stored in Protein LoBind tubes (Eppendorf) at −80°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein samples were aliquoted into Protein LoBind tubes (Eppendorf) and polymerised at 30°C quiescently for at least 48 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... The protein sample was processed in Protein LowBind Tube (Eppendorf) during each step ...
-
bioRxiv - Biophysics 2020Quote: ... Tween treated Protein LoBind tubes (Protein LoBind Tubes (1.5 ml, Eppendorf)) were incubated for 4 hours with 2% aqueous Tween solution (Tween20 ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Protein LoBind tubes (Eppendorf) and epT.I.P.S ...
-
bioRxiv - Cell Biology 2020Quote: ... protein Lobind tubes (Eppendorf). Elution was repeated and the eluates were pooled ...
-
bioRxiv - Microbiology 2022Quote: ... Protein LoBind tubes (Eppendorf) minimized potential adsorption of protein ...
-
bioRxiv - Immunology 2022Quote: ... incubated with each antigen at certain concentration in PBS/2% FCS and transfer to a 37°C thermomixer (Eppendorf). Cells were collected after each period of incubation and fixed in IC fixation buffer on ice for 30 mins and at RT for additional 30 mins ...
-
bioRxiv - Biochemistry 2024Quote: ... heat- denatured FCS matrix was a supernatant obtained after spinning (15,000 g, 15 minutes, 4 °C) 100% FCS (200 uL; 1.7 mL Eppendorf tubes) heated at 85°C for 15 minutes in a Thermomixer Comfort heating block (Eppendorf ...
-
bioRxiv - Microbiology 2024Quote: ... 100 µg of protein was transferred into a protein LoBind® tube (Eppendorf) and alkylated by adding 2 µL of 200 mM iodoacetamide (IAM ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Plant Biology 2024Quote: ... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
bioRxiv - Biochemistry 2024Quote: ... All protein was for this assay was handled with Protein LoBind® Tubes (Eppendorf) and Low Binding TripleA pipette tips (Westburg ...
-
bioRxiv - Immunology 2022Quote: ... For that 2.5x105 cells were incubated with HIV-1 antigens in PBS/2% FCS for the indicated period of times on a 37°C thermomixer (Eppendorf). Cells were then fixed with IC fixation buffer on ice for 30 mins and at RT for additional 30 mins ...
-
bioRxiv - Physiology 2021Quote: ... in protein LoBind tubes (Eppendorf). Probes were then homogenized at 4°C in Bioruptor Pico sonicator (Diagenode) ...
-
bioRxiv - Neuroscience 2024Quote: ... protein low-binding tubes (Eppendorf) were used ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein amounts were assessed using a Pierce BCA protein assay kit and spectrophotometer (Eppendorf BioPhotometer). Equal amounts of protein (15 μg ...
-
bioRxiv - Neuroscience 2020Quote: ... The supernatant with eluted biotinylated proteins was carefully transferred to a low-protein-binding tube (Eppendorf) with a 30g needle and stored at −80°C.
-
bioRxiv - Biophysics 2024Quote: Protein was pre-incubated in the desired buffer in a 1.5 ml Protein LoBind tube (Eppendorf). Buffer that would be added to the protein was premixed in a 1.5 ml microcentrifuge tube ...
-
bioRxiv - Biochemistry 2024Quote: ... the protein was stored in 20 µl of aliquots in 1.5 ml Protein LoBind Tubes (Eppendorf) and was flash-frozen in liquid nitrogen for future use.
-
bioRxiv - Cell Biology 2020Quote: ... transferred to protein LoBind tubes (Eppendorf), and minced ...
-
bioRxiv - Molecular Biology 2020Quote: ... into protein LoBind tubes (Eppendorf, Germany). Just before encapsulation ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Low protein binding tubes (022431081, Eppendorf) were used for sample preparation ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein LoBind® tubes from Eppendorf; Trypsin (V5111 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Low protein binding tubes (022431081, Eppendorf) were used for sample preparation ...
-
bioRxiv - Biophysics 2022Quote: ... aliquoted into Protein LoBind tubes (Eppendorf), and stored at 4°C (maximum 48 hours ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Neuroscience 2024Quote: ... regionalized neural organoids (1-3 organoids per one Eppendorf tube) were transferred into a 1.5 mL Eppendorf tube containing 200 μL of the neural medium ...
-
bioRxiv - Genomics 2022Quote: ... Digestion of proteins using a GELFREE 8100 fractionator was performed in protein low binding tubes (Eppendorf, Hamburg, Germany) using the Single-Pot Solid-Phase-enhanced Sample Preparation technique described previously (Hughes et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... Protein was quantified on a BioSpectrometer (Eppendorf) with a Bradford Assay (Bradford Reagent-E530-1L) ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein LoBind microfuge tubes (1.5 ml, Eppendorf) were used to further minimize non-specific binding to the walls of the reaction vessel ...
-
bioRxiv - Microbiology 2020Quote: ... The protein content was colorimetrically determined (Eppendorf Biophotometer ...
-
bioRxiv - Molecular Biology 2024Quote: ... and stored in Protein LoBind tubes (Eppendorf) at −80°C.
-
bioRxiv - Immunology 2022Quote: ... The antigen was diluted in tubes with a low binding capacity for proteins (Eppendorf Protein LoBind Tube 1.5 ml). Second ...