Labshake search
Citations for Eppendorf :
51 - 100 of 796 citations for Dengue Virus Serotype 3 Envelope Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... aliquoted into Protein LoBind tubes (Eppendorf), and stored at 4°C (maximum 48 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... antibodies in Protein LoBind tubes (Eppendorf). Thereafter ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Low protein binding tubes (022431081, Eppendorf) were used for sample preparation ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Genomics 2022Quote: ... Digestion of proteins using a GELFREE 8100 fractionator was performed in protein low binding tubes (Eppendorf, Hamburg, Germany) using the Single-Pot Solid-Phase-enhanced Sample Preparation technique described previously (Hughes et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... Protein was quantified on a BioSpectrometer (Eppendorf) with a Bradford Assay (Bradford Reagent-E530-1L) ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein LoBind microfuge tubes (1.5 ml, Eppendorf) were used to further minimize non-specific binding to the walls of the reaction vessel ...
-
bioRxiv - Microbiology 2020Quote: ... The protein content was colorimetrically determined (Eppendorf Biophotometer ...
-
bioRxiv - Molecular Biology 2024Quote: ... and stored in Protein LoBind tubes (Eppendorf) at −80°C.
-
bioRxiv - Immunology 2022Quote: ... The antigen was diluted in tubes with a low binding capacity for proteins (Eppendorf Protein LoBind Tube 1.5 ml). Second ...
-
bioRxiv - Neuroscience 2019Quote: ... Protein concentration of the supernatant was determined by measuring protein absorbance at 280 nm using a photometer (BioPhotometer, Eppendorf) and employing the Beer-Lambert law ...
-
bioRxiv - Biochemistry 2020Quote: ... Measurements at different protein concentrations were carried out by adding to the reaction small volumes of protein diluted in RB in ‘Protein LoBind’ 1.5 mL tubes (Eppendorf). No oxygen-scavenging or triplet-quenching additives were used.
-
bioRxiv - Biochemistry 2021Quote: ... Dynabeads were separated magnetically and elution buffer containing biotinylated proteins was transferred to a new 1.5 ml LoBind protein tube (Eppendorf). 70 µl of sample was electrophoresed on a NuPAGETM 4-12% Bis-Tris protein gel (Invitrogen) ...
-
bioRxiv - Biochemistry 2022Quote: ... the supernatant was removed and cells were resuspended in cold PBS at 20 million cells/mL and then distributed into 1.5 mL microcentrifuge tubes (Eppendorf Protein LoBind tubes (Z666505-100EA) at 1 mL each ...
-
bioRxiv - Plant Biology 2019Quote: ... A volume of each protein extract corresponding to 16 mg protein was transferred into a new 5 ml LoBind tube (Eppendorf) containing Dynabeads MyOne Streptavidin C1 (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... The protein concentration was determined according to the Bradford method (BioRad protein Assay, Spectrophotemeter Eppendorf biophotometer plus at 595 nm). Full-length APP and APP-CTFs were resolved on 16.5% Tris-Tricine SDS-PAGE then transferred onto nitrocellulose membranes which were boiled in PBS ...
-
bioRxiv - Biochemistry 2019Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... proteins were dried in a vacuum concentrator (Eppendorf) and resolubilized in 50 µL of 100 mM TEAB ...
-
bioRxiv - Microbiology 2020Quote: ... Hemolymph was collected into protein LoBind tubes (Eppendorf) from 60 cold anesthetized mosquitoes 20 min post-injection into 48 μL collection buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... The protein was loaded in Femtotips II (Eppendorf) and injection was done with an injection pressure of 1.0 hPa ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentrations were measured by using BioSpectrometer (Eppendorf).
-
bioRxiv - Cancer Biology 2023Quote: ... then transferred to a protein LoBind tube (Eppendorf) for overnight digestion ...
-
bioRxiv - Biochemistry 2023Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were mixed in protein LoBind tubes (Eppendorf) and then immediately transferred into a 96-well non-binding plate (Greiner Bio-one) ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Samples were mixed in protein LoBind tubes (Eppendorf, 022431064) and then immediately transferred onto 18-well glass-bottom chamber slides (iBidi ...
-
bioRxiv - Biochemistry 2021Quote: ... were transferred to protein low-bind microcentrifuge tubes (Eppendorf) and washed with 1 mL co-IP wash buffer (50 mM Tris-HCl ...
-
bioRxiv - Microbiology 2022Quote: ... Protein concentration was measured using a BioPhotometer D30 (Eppendorf). For storage ...
-
bioRxiv - Plant Biology 2021Quote: ... in protein low binding 1.5 mL tubes (LoBind, Eppendorf) by slowly pipetting against the side of the tube ...
-
bioRxiv - Microbiology 2021Quote: ... Protein concentration was measured using a BioPhotometer D30 (Eppendorf). Additional purification of the Ni-affinity purified NixI and NixIN95A was carried out using a Heparin column ...
-
bioRxiv - Biochemistry 2022Quote: ... Serial dilutions were performed in Protein LoBind tubes (Eppendorf) coated with Bovine Serum Albumin Standard protein (ThermoScientific ...
-
bioRxiv - Biophysics 2022Quote: ... in a protein lo-bind tube (Eppendorf, Hamburg, Germany). Both recombinant proteins were a gift from the Alberti group (Max Planck Institute of Molecular Cell Biology and Genetics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Lysates were transferred into 1.5ml protein lobind tubes (Eppendorf), centrifuged at maximum speed for at least 30 minutes at 4°C and supernatants were transferred into new 1.5ml tubes ...
-
bioRxiv - Molecular Biology 2023Quote: ... slurry in 1.5 mL Protein Lo Bind Tubes (Eppendorf). SNAP-tagged LIS1 constructs were first covalently coupled to beads by incubating 50 μL of 1 μM of the respective protein at room temperature for 30 min ...
-
bioRxiv - Biophysics 2023Quote: ... Protein LoBind tubes were purchased from Eppendorf (Hamburg, Germany). µ-Slide 8 well glass bottoms were purchased from Ibidi USA inc ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... moved to a Protein LoBind 96-well plate (Eppendorf) and destained with several alternating washes of freshly prepared solutions of 50 mM ammonium bicarbonate (Ambic) ...
-
bioRxiv - Neuroscience 2024Quote: ... Serum was aliquoted into protein LoBind tubes (Eppendorf, Germany) and stored at -80 °C until analysis ...
-
bioRxiv - Neuroscience 2024Quote: ... CSF was collected into protein LoBind tubes (Eppendorf, Germany), immediately put on dry ice and stored at -80 °C until analysis ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Microbiology 2019Quote: ... Loaded microfluidic chambers were centrifuged 3 min at 1000 rcf (Eppendorf centrifuge 5430R) to maximize cell adhesion.
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and supernatants were transferred into new protein LoBind tubes (Eppendorf). Extracted proteins were quantified using Pierce BCA Protein Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and aliquoted in 0.5 mL low binding protein tubes (Eppendorf). A bicinchoninic acid protein (BCA ...
-
bioRxiv - Neuroscience 2021Quote: ... the lysates were moved to Protein LoBind tubes (Eppendorf 02243108), vortexed ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 mM Dithiothreitol (DTT)) in a protein LoBind tube (Eppendorf) and incubated at 30°C for 30 min in a MS100 Thermoshaker at 1500 rpm ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein concentration was determined spectrophotometrically at 280 nm (μCuvette, Eppendorf) using a theoretical extinction coefficient for Fp231 of 110935 M-1·cm-1 (ProtParam ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant was transferred to a protein LoBind tube (Eppendorf) and frozen at −20 °C.
-
bioRxiv - Cancer Biology 2020Quote: ... peptides were aliquoted into 0.5 mL Protein LoBind tubes (Eppendorf), lyophilized and stored at −80 °C until needed ...