Labshake search
Citations for Eppendorf :
1 - 50 of 290 citations for Adenovirus Type 5 Particles CMV β galatosidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... Deep red-) Single cells were sorted into 5 ul of RLT 1%β-Mercaptoethanol in a 96 well plate (Eppendorf) and frozen at −80°C.
-
bioRxiv - Neuroscience 2022Quote: ... Particles were collected by centrifugation at 1000 xg for 10 minuntes (Eppendorf centrifuge 5864 R ...
-
bioRxiv - Biophysics 2020Quote: ... For single particle tracking experiments DNA origami was diluted in DNA LoBind tubes (Eppendorf) and added to a chamber at a final concentration of 0.1-1 pM ...
-
bioRxiv - Genetics 2024Quote: ... 30mg of gold particles (Gold powder 0.3-3micron/99.9% from chemPUR) were transferred in a 1.5mL tubes (DNA LoBind, Eppendorf), vortexed with 1mL 70% EtOH for 5min ...
-
bioRxiv - Plant Biology 2019Quote: ... the root extremity was introduced into a plastic tube (Eppendorf type) through a hole pierced at the tube bottom and sealed with silicon paste to collect exuded sap for 24 h ...
-
bioRxiv - Zoology 2020Quote: ... Each blood sample was centrifuged in a microcentrifuge (type 5424, Eppendorf, Hamburg, Germany) at 8000 rpm for 5 minutes and the separated plasma was frozen at −80 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... for RERE (30 cycles) and β-ACTIN (20 cycles) using a thermocycler (Eppendorf) and then separated on an agarose gel (Alkali Scientific) ...
-
bioRxiv - Plant Biology 2021Quote: ... The cell extract was collected on ice and larger particles were separated by sequentially centrifuged at 1,000 xg for 10 min (Eppendorf 5810R), 3,000 xg for 20 min ...
-
bioRxiv - Neuroscience 2022Quote: ... Particles were collected by centrifugation at 1000 xg for 10 minuntes (Eppendorf centrifuge 5864 R, Eppendorf North America, Hauppauge, NY) and washed three times by discarding the supernatant ...
-
bioRxiv - Molecular Biology 2023Quote: ... After centrifugation at 20817 × g for 10 minutes to remove all matrix particles the resulting lysate was transferred to a fresh 2.0 mL Lo-Bind tube (Eppendorf, Germany). DNA was isolated from the lysate using two approaches ...
-
bioRxiv - Neuroscience 2023Quote: ... The cell culture supernatant was collected and pre-cleared from cells and larger particles by centrifugation at 400 × g at 4 °C for 10 min (Eppendorf 5810R) and 10,000 × g at 4 °C for 30 min (Eppendorf 5910R) ...
-
bioRxiv - Neuroscience 2022Quote: ... Medium containing viral particles was harvested approximately 72 h later through low-speed centrifugation at 1.500 g in an Eppendorf centrifuge (Eppendorf 5810R, Hamburg, Germany) for 5 min ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5 % CO2 (Eppendorf). Jurkat CD4-KO cells were derived from wild-type Jurkat T cells (clone E6 ...
-
bioRxiv - Biophysics 2020Quote: 5) Centrifuge (Eppendorf, 5810R)
-
bioRxiv - Neuroscience 2023Quote: ... 5 % CO2 using microloaders (Eppendorf). Slices were placed into the incubation chambers one at a time (minimum volume 1.5 ml to cover raised grid) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transferred at blastula stages into Tg(kdrl:Hsa.HRAS-mCherry)s916 wild-type hosts using CellTram 4R Oil hydrolic microinjector (Eppendorf). Donor embryos were genotyped immediately after transplantation.
-
bioRxiv - Cell Biology 2023Quote: ... transferred in 5 ml tubes (Eppendorf) and 480 μl Triton-X-100 (2% [vol/vol] final concentration ...
-
bioRxiv - Biochemistry 2021Quote: ... β-chitin aliquots from the culture flasks were transferred to 2 mL Safe-Lock Eppendorf tubes (Eppendorf, Hamburg, Germany) and boiled directly for 5 min in 30 µL NuPAGE LDS sample buffer and NuPAGE sample reducing agent (Invitrogen™ ...
-
bioRxiv - Neuroscience 2019Quote: ... supplemented with 3.5 µl 2-β mercaptoethanol was added directly to the beads and incubated with mixing on a ThermoMixer (Eppendorf) for 10 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 mM β-glycerol phosphate and 2.5 mM Na2H2P2O7).) and cells scraped and transferred into Protein Lo-bind tubes (Eppendorf). Samples were sonicated for 10 cycles (30s on & 40s off ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 3.5Lμl 2-β mercaptoethanol (#444203, MilliporeSigma) was added directly to the beads and incubated with mixing on a ThermoMixer (Eppendorf) for 10□min at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... supplemented with 3.5 μL 2-β mercaptoethanol was added directly to the beads and incubated with mixing on a ThermoMixer (Eppendorf) for 10 minutes at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... supplemented with 3.5Lμl 2-β mercaptoethanol (#444203, MilliporeSigma) was added directly to the beads and incubated with mixing on a ThermoMixer (Eppendorf) for 10Lmin at room temperature ...
-
bioRxiv - Immunology 2020Quote: Using 5 mL lo-bind tubes (Eppendorf), 960 μL of ice-cold methanol was added to ~1 mL of protein supernatant and vortexed briefly before subsequent addition of 160 μL of ice-cold chloroform and thorough mixing ...
-
bioRxiv - Neuroscience 2024Quote: ... placed in 5-ml tubes (Eppendorf, 0030119452) and dehydrated 1h in each methanol baths (50% ...
-
bioRxiv - Bioengineering 2022Quote: ... Subsequent washes were performed at a volume of 5 mL in 5 mL Eppendorf tubes (Cat. No. 0030122321, Eppendorf) and pelleted with a compatible microcentrifuge (MC-24™ Touch ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2019Quote: ... incubated for 5 min at 4 °C with rotation and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Neuroscience 2021Quote: ... a whole eye from wild type and mutant adult zebrafish or 100 zebrafish mutant larvae were transferred to 2 ml Eppendorf microcentrifuge tubes (Eppendorf, Hamburg, Germany). 200 μl of 2 M hydroxylamine (pH 8 ...
-
bioRxiv - Genetics 2022Quote: ... The mix was micro-injected in the gonads of young adult N2 Bristol wild types (Zeiss Axio Observer A1 with Eppendorf Femtojet and Eppendorf Injectman NI2)(Mello et al ...
-
bioRxiv - Microbiology 2019Quote: ... in a 5 mL tube (Eppendorf, Hamburg, Germany). Tubes were kept as cold as possible while in the field (usually for less than 8 h ...
-
bioRxiv - Developmental Biology 2019Quote: ... at 5% CO2 (Eppendorf® New Brunswick Galaxy170S). Media was changed every day and cells were passaged upon reaching 80% confluence ...
-
bioRxiv - Cell Biology 2019Quote: ... shaked for 5 min on a thermomixer (Eppendorf) at room temperature and centrifuged for 20 min at 4°C full speed ...
-
bioRxiv - Microbiology 2023Quote: ... vortexed for 5 min and then centrifuged (Eppendorf Centrifuge model 5810 R ...
-
bioRxiv - Microbiology 2023Quote: ... centrifuging for 5 min at 7,500 rcf (Eppendorf, tabletop centrifuge MiniSpin plus with rotor F-45-12-11) ...
-
bioRxiv - Cell Biology 2020Quote: ... 5000 rpm for 5 min in 5415D centrifuge (Eppendorf) to remove aggregates.
-
bioRxiv - Genomics 2022Quote: ... typically a 5 mL Lo-bind tube (0030122348, Eppendorf) or 15 mL falcon tube (229410 ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were pooled in 5 mL LoBind tubes (Eppendorf) in 1 mL chilled lysis buffer (10 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2024Quote: ... centrifuged at 1200 RPM for 5 minutes (Eppendorf 5180) and stained for cell viability using Fixable Live/Dead Blue for 30 min at 4°C ...
-
bioRxiv - Genetics 2022Quote: ... The mix was micro-injected in the gonads of young adult N2 Bristol wild types (Zeiss Axio Observer A1 with Eppendorf Femtojet and Eppendorf Injectman NI2)(Mello et al ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Bioengineering 2019Quote: ... for 5 minutes at 3,500 RPM (2,465 x g, Eppendorf 5810R v3.3 centrifuge with A-4-62 rotor ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Cell Biology 2023Quote: ... in a 5% CO2 containing humidified incubator (Eppendorf Galaxy 170S) at 37°C.