Labshake search
Citations for Eppendorf :
1 - 50 of 670 citations for 8 chloro 10 3 dimethylamino propyl phenothiazin 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 10 mM HEPES and seeded on confluent HFF monolayers in 8-well chamber slides (Eppendorf) at a density of 5×105 tachyzoites/well ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Biochemistry 2022Quote: ... with 200 μL of 3.2 mm round beads at for 10 min at setting 8 in 1.8 mL microcentrifuge vials (Eppendorf Safe-Lock). Homogenates were transferred to a new microcentrifuge vial and briefly placed on ice for phase separation before centrifugation at 14,000 × g for 15 minutes ...
-
bioRxiv - Cell Biology 2020Quote: 8 well chambered cover glasses (Eppendorf, 0030742036) were coated with 50 μg/mL Growth factor reduced basement membrane matrix (Matrigel® ...
-
bioRxiv - Neuroscience 2022Quote: ... Using an electronic 8-channel pipette (Eppendorf) at low dispense speed ...
-
bioRxiv - Cell Biology 2021Quote: ... or 8-well glass-bottom chambers (Eppendorf). Cells were transiently transfected by Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8% CO2 in a S41i incubator (Eppendorf) for 5 days.
-
bioRxiv - Cell Biology 2022Quote: 8-well cover-glass bottom dishes (Eppendorf, 0030742036) were plasma cleaned and immediately coated with 0.5 mg/mL Concanavalin A (Sigma ...
-
bioRxiv - Biochemistry 2020Quote: ... frozen leaves were extracted in 50 mM P buffer (pH 7.5) at a ratio of 1:8 (w/v) and centrifuged (Eppendorf 5417R) twice at 18,000g for 20 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... seeded in 8-well chambered cover glass (Eppendorf 0030742036), and supplemented with a defined medium ...
-
bioRxiv - Physiology 2019Quote: ... The remaining homogenate was heated for 10 min at 70°C and spun for 3 min at top speed at 4°C (Eppendorf 5415R). The supernatant was transferred to a new tube and heated for 10 min at 70°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were vigorously vortex-mixed for 3 min and centrifuged at 14,000 rpm for 10 min at 4 °C (Eppendorf 5804 R). The clear supernatant was then transferred to a separate vial ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Cell Biology 2023Quote: ... Resuspended lipid extracts were diluted 1:10 in 96-well plates (Eppendorf twin tec 96 ...
-
bioRxiv - Bioengineering 2023Quote: ... MPCs were washed twice for 3 min at 400 RCF at room temperature with PBS supplemented with 1% glucose and 1% pen-strep (Eppendorf 5702R, Hamburg, Germany). Biotinylation of the cell surface was performed by adding 1 mM Sulfo-NHS-LC-Biotin (Thermo Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Neuroscience 2020Quote: ... Stimulations were performed with automated 8 channel pipettes (Eppendorf, Hamburg, DE) at low dispense speed on heated blocks ...
-
bioRxiv - Cell Biology 2023Quote: Cells grown on glass coverslips or 8-well chamber slides (Eppendorf) were either fixed for 10 min with 4% (v/v ...
-
bioRxiv - Biophysics 2021Quote: ... diluted 1:10 in 96-well plates (Eppendorf twin.tec® 96; Sigma-Aldrich). Cholesterol measurements were performed in positive ion mode ...
-
bioRxiv - Microbiology 2022Quote: ... Two-microliter aliquots of resuspended lipids were diluted 1:10 in 10 mM ammonium acetate in methanol in 96-well plates (Eppendorf twin tec 96) prior to measurement ...
-
bioRxiv - Microbiology 2022Quote: ... Two μl aliquots of the resuspended lipids were diluted 1:10 in 10 mM ammonium acetate in methanol in 96-well plates (Eppendorf twin tec 96) prior to measurement ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: 15,000 cells were seeded in 8-well chamber cover glass (Eppendorf, 0030742036). After 24 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mixture was sonicated 3 times for 1 minute in a waterbath sonicator and incubated in a ThermoMixer (Eppendorf) for 30 minutes at 37°C and 500 rpm ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 8 animals were kept at each concentration in a 48-well plate (Eppendorf) and imaged in brightfield at 4x with an Invitrogen EVOS Fl Auto 2 (Thermo-Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... and overlayed with Matrigel including medium in 8 well chamber coverglass (0030742036; Eppendorf) as previously described (Debnath et al. ...
-
bioRxiv - Microbiology 2021Quote: ... were used in combination with an 8-channel 50-µL volume adaptor (Eppendorf). Each deep-well culture was used to inoculate 2 96-well flat-bottom plates as replicates for the growth curve measurements ...
-
bioRxiv - Biophysics 2022Quote: ... the DNA droplet-containing aqueous phase was layered on top of the oil phase in a volumetric ratio of 1:3 within a microtube (Eppendorf). For the segregation of DNA droplets using enzymatic activity ...
-
bioRxiv - Biophysics 2022Quote: ... The aqueous solution was layered on top of the oil-surfactant mix in a volumetric ratio of 1:3 inside a microtube (Eppendorf). The tube was manually shaken for about 30 s until water-in-oil droplets formed ...
-
bioRxiv - Biochemistry 2019Quote: ... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
bioRxiv - Biophysics 2020Quote: ... the DNA-containing aqueous phase was layered on top of the oil phase in a volumetric ratio of 1:3 within a microtube (Eppendorf). Droplet formation was induced by manual shaking for about 4 s as described earlier.[26] For the oil-phase ...
-
bioRxiv - Genomics 2024Quote: ... and washed in nuclease-free H2O before proceeding to MNase digestion with 1-2U of MNase for 3×106 cells that went on for 1-hour at 37C while shaking in a thermomixer (Eppendorf) at 550rcf ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15.76 g EDTA (pH 8)) in 2 mL Safe-Lock tubes (Eppendorf, Hamburg, Germany). The QIAamp DNA Mini Kit (QIAGEN ...
-
bioRxiv - Bioengineering 2021Quote: ... each pre-culture was diluted 1:10 and the OD600 was measured with the BioSpectrometer (Eppendorf). The OD was then adjusted to 0.1 in YPM medium and three replicates with 300 μL of each pre-culture were transferred to a 48-sterile well plate and mixed (360 rpm ...
-
bioRxiv - Neuroscience 2022Quote: ... Lysate was spun at 800 g for 10 min (spin 1) to remove cell debris (Eppendorf Centrifuges 5430 with Eppendorf FA-45-48-11 30-spot 45-degree fixed angel rotor) ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Plant Biology 2024Quote: ... SDS at a 1:3 (w/v) ratio and extracted by shaking 1000 RPM 95 °C for using a tabletop shaker (Eppendorf ThermoMixer F2.0). Samples were then centrifuged at 20,000 xg for 10 min at room temperature and the supernatant retained in new tubes ...
-
bioRxiv - Biochemistry 2022Quote: ... and 8% CO2 in a New Brunswick S41i CO2 Incubator (New Brunswick Eppendorf, Hamburg, Germany) for 4 days and passaged twice to 0.5×106 cell/mL into a 250 mL shake flask and then into a 500 mL shake flask ...
-
bioRxiv - Biophysics 2021Quote: ... in particular to adjust reactions volumes to the 8- or 12-channel pipettes (Eppendorf, Hamburg, Germany), repetitive pipette HandyStep (Brand ...
-
bioRxiv - Molecular Biology 2019Quote: ... Phenol-chloroform (50:50) was added and cells were vortexed for 8 min (Eppendorf mixer 5432). The DNA was ethanol precipitated and resuspended in 40-50 µL TE (10 mM Tris ...
-
bioRxiv - Neuroscience 2020Quote: ... was added to a reagent-to-antibody molar ratio 10:1 in Protein LoBind tubes (Eppendorf, Hamburg, Germany), and the solutions were incubated for 1 h at room temperature under constant shaking at 500 rpm ...
-
bioRxiv - Bioengineering 2023Quote: ... in LB (10 g Tryptone, 5 g Yeast Extract, 10 g NaCl) grown in a 10 L BioFlo 320 Fermenter (Eppendorf). At inoculation ...
-
bioRxiv - Plant Biology 2020Quote: ... shaken for 10 minutes at 10°C in a Thermomixer (Eppendorf®), and then centrifuged (8000 g ...
-
bioRxiv - Plant Biology 2022Quote: ... shaken for 10 minutes at 10°C in a Thermomixer (Eppendorf®) and then centrifuged (8,000g ...
-
bioRxiv - Biochemistry 2023Quote: ... placed on an orbital shaker platform rotating at 125 rpm at 37 °C with 8 % CO2 (Eppendorf). On the day of transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Biophysics 2020Quote: ... or 1 mM LY294,002 and 10 μg/ml Alexa594 were prepared in DB and loaded into Femtotips II (Eppendorf). The tip mounted on the micromanipulator (TransferMan 4r or TransferMan NK2 ...
-
bioRxiv - Microbiology 2021Quote: ... cells equivalent to 1 OD600 were pelleted by centrifugation at 2,808 x g for 10 min (Eppendorf 5810 R) and the pellets were flash frozen ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reactions were run in simplex at 1 and 10-fold dilutions on a Mastercycler® Nexus Gradient (Eppendorf, Germany). Optimised PCR Ta were compared to Ta=50°C as used by Ollivier et al ...
-
bioRxiv - Biochemistry 2022Quote: Wholemeal flour samples were weighed (~8 mg) and transferred into a deep well plate (96/1000 μL, Eppendorf), each well containing 20 μL of DMSO and a 3 mm glass ball to improve mixing ...