Labshake search
Citations for Eppendorf :
1 - 50 of 192 citations for 8 Bromo 6 chloro 2H chromene 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... and lyophilized for 2h in an Eppendorf concentrator (Eppendorf) and stored at −80°C until use.
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1% SDS for 2h at 50°C with shaking at 500rpm using Thermomixer (Eppendorf). Then ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Developmental Biology 2021Quote: ... diluted 1:250 in 500ul PBSFBT either ON or for 2h at 32°C in a heating block (ThermoMixer C, Eppendorf) with integrated shaking (350rpm) ...
-
bioRxiv - Bioengineering 2022Quote: ... tumors were minced using a razor and digested with 1mg/ml collagenase A and collagenase D and 0.4mg/ml DNase I in PBS at 37°C for 2h with rotation at 600rpm in a thermomixer compact (Eppendorf). 10mM EDTA was then added to stop the enzymatic reaction ...
-
bioRxiv - Cell Biology 2020Quote: 8 well chambered cover glasses (Eppendorf, 0030742036) were coated with 50 μg/mL Growth factor reduced basement membrane matrix (Matrigel® ...
-
bioRxiv - Neuroscience 2022Quote: ... Using an electronic 8-channel pipette (Eppendorf) at low dispense speed ...
-
bioRxiv - Cell Biology 2021Quote: ... or 8-well glass-bottom chambers (Eppendorf). Cells were transiently transfected by Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8% CO2 in a S41i incubator (Eppendorf) for 5 days.
-
bioRxiv - Cell Biology 2022Quote: 8-well cover-glass bottom dishes (Eppendorf, 0030742036) were plasma cleaned and immediately coated with 0.5 mg/mL Concanavalin A (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... seeded in 8-well chambered cover glass (Eppendorf 0030742036), and supplemented with a defined medium ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 6–6 droplets for the remaining days) were inoculated into 150-mm Petri dishes (Eppendorf, Hamburg, Germany), and the cells were allowed to attach to the surface for 2 h in a CO2 incubator (5% CO2 and 90% humidity) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Neuroscience 2020Quote: ... Stimulations were performed with automated 8 channel pipettes (Eppendorf, Hamburg, DE) at low dispense speed on heated blocks ...
-
bioRxiv - Cell Biology 2023Quote: Cells grown on glass coverslips or 8-well chamber slides (Eppendorf) were either fixed for 10 min with 4% (v/v ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: 15,000 cells were seeded in 8-well chamber cover glass (Eppendorf, 0030742036). After 24 h ...
-
bioRxiv - Bioengineering 2020Quote: The cjFFs were transfected at P4-6 with Multiporator (Eppendorf) according to the protocol provided by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: ... with an fixed angled-rotor (FA-45-6-30, Eppendorf) and the virus pellet was resuspended in OPC-Sato medium for 1 hour at 4°C on a shaker ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 8 animals were kept at each concentration in a 48-well plate (Eppendorf) and imaged in brightfield at 4x with an Invitrogen EVOS Fl Auto 2 (Thermo-Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... and overlayed with Matrigel including medium in 8 well chamber coverglass (0030742036; Eppendorf) as previously described (Debnath et al. ...
-
bioRxiv - Microbiology 2021Quote: ... were used in combination with an 8-channel 50-µL volume adaptor (Eppendorf). Each deep-well culture was used to inoculate 2 96-well flat-bottom plates as replicates for the growth curve measurements ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Molecular Biology 2021Quote: ... complete amino acid supplementation) overnight in 96-well flat bottom plates (Eppendorf), diluted into fresh medium with a dilution factor of 200 ...
-
bioRxiv - Biochemistry 2021Quote: ... Unreacted dye was removed by two passages over an equilibrated Bio-spin® 6 column filled with Bio-gel P-6 media in labeling buffer and centrifuged in a tabletop centrifuge (Eppendorf 5810 R, rotor A-4-62) at 1500 rpm for 3 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15.76 g EDTA (pH 8)) in 2 mL Safe-Lock tubes (Eppendorf, Hamburg, Germany). The QIAamp DNA Mini Kit (QIAGEN ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL droplets were inoculated into 6-well plates (Eppendorf, Hamburg, Germany). After allowing the cells to adhere to the surface for 2 hours in a CO2 incubator (37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... for 6 h at 37 °C at 800 rpm (shaking incubator, Eppendorf). After RNAse A was removed by centrifugation ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA samples were collected in 2.0 ml nucleic acid LoBind tubes (Eppendorf) and stored at −80 °C ...
-
bioRxiv - Microbiology 2022Quote: ... 10 mM HEPES and seeded on confluent HFF monolayers in 8-well chamber slides (Eppendorf) at a density of 5×105 tachyzoites/well ...
-
bioRxiv - Biochemistry 2022Quote: ... and 8% CO2 in a New Brunswick S41i CO2 Incubator (New Brunswick Eppendorf, Hamburg, Germany) for 4 days and passaged twice to 0.5×106 cell/mL into a 250 mL shake flask and then into a 500 mL shake flask ...
-
bioRxiv - Developmental Biology 2023Quote: ... Organoids were transferred to a 6 cm ultra-low-attachment dish (Eppendorf, 30701011) containing Tyrode’s solution (Sigma ...
-
bioRxiv - Biophysics 2021Quote: ... in particular to adjust reactions volumes to the 8- or 12-channel pipettes (Eppendorf, Hamburg, Germany), repetitive pipette HandyStep (Brand ...
-
bioRxiv - Molecular Biology 2019Quote: ... Phenol-chloroform (50:50) was added and cells were vortexed for 8 min (Eppendorf mixer 5432). The DNA was ethanol precipitated and resuspended in 40-50 µL TE (10 mM Tris ...
-
bioRxiv - Cell Biology 2020Quote: ... or western blot analysis (200 000 cells in 6-well plates (Eppendorf, cat# 0030720113) were left to attach for 48h ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then seeded in a Matrigel-coated 6-well plate (Eppendorf, cat # 0030720113) to 2.5×106 cells/well with dual SMAD inhibitor media supplemented with Dorsomorphin (1μM ...
-
bioRxiv - Biochemistry 2023Quote: ... placed on an orbital shaker platform rotating at 125 rpm at 37 °C with 8 % CO2 (Eppendorf). On the day of transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Bioengineering 2019Quote: ... centrifuging for 5 min at 400 rcf (RT, Eppendorf 5430; Rotor: F-35-6-30), re-suspension in fresh medium and transfer to cultivation flask.
-
bioRxiv - Biochemistry 2021Quote: ... cells were seeded into 6-well or 12-well polystyrene coated plates (Eppendorf; EP0030720130, EP0030721012) at a density of 0.3 x 106 cells mL−1 or 0.1 x 106 cells mL−1 ...
-
bioRxiv - Biochemistry 2022Quote: Wholemeal flour samples were weighed (~8 mg) and transferred into a deep well plate (96/1000 μL, Eppendorf), each well containing 20 μL of DMSO and a 3 mm glass ball to improve mixing ...
-
bioRxiv - Biochemistry 2023Quote: ... 380 μL samples of 8 μM aSyn solutions were incubated in Protein LoBind polypropylene tubes (Eppendorf, ref.0030108.116) at 37 °C under quiescent conditions over 10 days in the absence and presence of a cylindrical 10 mm x 3mm Teflon stirring bar (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... Eluted lysates in 60% acetonitrile/0.1% formic acid were dried by vacuum centrifugation (Eppendorf; Concentrator Plus) at 45°C.
-
bioRxiv - Biochemistry 2023Quote: ... in 0.3% acetic acid was added to a 96-well plate (CAT# 0030128664, Eppendorf, Hamburg, Germany), sealed with plate seal (CAT# 5010-21951 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and then 6 mL of the culture was collected by centrifugation at 2,500g (5810 R, Eppendorf) for 5 min at room temperature.
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Resulting cDNA was diluted 1:8 and subjected to endpoint RT-PCR using Taq DNA Polymerase (GeneDirex Inc., Taoyuan, Taiwan) in a Mastercycler Nexus (Eppendorf) or Bio-Rad T100 thermocycler ...