Labshake search
Citations for Eppendorf :
101 - 150 of 1404 citations for 7H Pyrrolo 2 3 d pyrimidine 7 3 5 bis O 2 4 dichlorophenyl methyl 2 C methyl b D ribofuranosyl 4 chloro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and Mastercycler ep Realplex 2 (Eppendorf). Data was normalized by GAPDH or sigA expression level and all primers were designed using GenScript primer design software ...
-
bioRxiv - Cancer Biology 2024Quote: ... on a RealPlex 2 Thermocycler (Eppendorf).
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2023Quote: ... and heated up to 37°C for 2 h while shaking (800 rpm, Thermomixer F1.5, Eppendorf). Following this ...
-
bioRxiv - Cell Biology 2023Quote: ... The digestion was performed for 2 h at 40 °C on a Thermomixer (750 rpm; Eppendorf). Tryptic peptides were extracted info LC-MS vials by 2.5% formic acid (FA ...
-
bioRxiv - Cell Biology 2019Quote: ... The lysate was centrifuged at 4°C at 3220 g for 15 min (Eppendorf #A-4-81 rotor) to remove intact cells and debris ...
-
bioRxiv - Synthetic Biology 2022Quote: The concentration and quality of the plasmid solutions were determined by diluting 1 ul of plasmid solution in 4 ul of Tris EDTA buffer and loading 3 ul of the diluted solution on a μCuvette G1 (Eppendorf). Optical densities were measured at 260 nm and 280 nm using a BioSpectrophotometer and Fluorimeter (Eppendorf) ...
-
bioRxiv - Neuroscience 2020Quote: ... for 30 min at 4°C on centrifuge (Eppendorf #5804R) and rotor (Eppendorf #S-4-72) ...
-
bioRxiv - Physiology 2023Quote: ... for 1 h at 4 □ on a ThermoMixer C (Eppendorf), 350 µl of water and 250 µl of chloroform were added to the mixture to induce phase separation ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by high-speed centrifugation (4°C, 12000rpm, Eppendorf, 5424R) for 20 minutes to collect the protein supernatant ...
-
bioRxiv - Biochemistry 2024Quote: ... #33045-U) and incubated for 2 h at 60 °C at 400 rpm on a thermomixer (Eppendorf ThermoMixer C, Germany, #EP5382000023). Then ...
-
bioRxiv - Immunology 2021Quote: ... The culture supernatant containing the virus was centrifuged at 4,500 g for 5 min at 4°C (Eppendorf 5810R) and stored at -80°C ...
-
bioRxiv - Genomics 2021Quote: ... 0.6 mM DTT) and pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Pulverized frozen tissue and pelleted nuclei from gentleMACS M-tubes were each split into two further aliquots ...
-
bioRxiv - Neuroscience 2020Quote: ... Isolated brain nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei pellets were resuspended in 1 ml nuclei permeabilization buffer (5 % BSA ...
-
bioRxiv - Genomics 2019Quote: ... Cells were thawed and pelleted in a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Cell pellets were resuspended in 250 μl nuclei permeabilization buffer (10 mM Tris-HCl pH 7.4 (Sigma) ...
-
bioRxiv - Genomics 2019Quote: ... Isolated brain nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei pellets were resuspended in 1 ml nuclei permeabilization buffer (5 % BSA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were put on ice for 30 min and precipitates were spun down for 5 min at 20,000 g at 4°C in a tabletop centrifuge (Eppendorf). After one wash with ice-cold acetone ...
-
bioRxiv - Microbiology 2023Quote: ... OD660 of 0.3-0.5 mid-log) were harvested by centrifugation (5,000 x g, 5 min at 4°C) (Eppendorf centrifuge 5430R). The supernatant was immediately discarded ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 million cells were added to a 5 mL DNA LoBind tube (Eppendorf, cat. no. 0030108310), centrifuged at 400 x g for 4 min ...
-
bioRxiv - Systems Biology 2023Quote: ... The samples were then distributed evenly over 2 x 5 mL reaction tubes (Eppendorf, Hamburg, Germany) and spun at 14,200 g for 15 min ...
-
bioRxiv - Developmental Biology 2019Quote: ... the tube was incubated at room temperature for 2 minutes on a thermomixer (Eppendorf Thermomixer C, #5382000023) set to 1250 rpm ...
-
bioRxiv - Genomics 2019Quote: ... the tube was incubated at room temperature for 2 minutes on a thermomixer (Eppendorf Thermomixer C, #5382000023) set to 1250 rpm ...
-
bioRxiv - Genomics 2021Quote: ... the tube was incubated at room temperature for 2 minutes on a thermomixer (Eppendorf Thermomixer C, #5382000023) set to 1250 rpm ...
-
bioRxiv - Neuroscience 2023Quote: ... They were then resuspended to a concentration of ∼800-3000 nuclei per uL across 3-4 x twin.tec™ 96 Well LoBind PCR Plates (Eppendorf, 0030129512) in NSB ...
-
bioRxiv - Cancer Biology 2023Quote: ... using a RealPlex 2 thermocycler (Eppendorf, 2894). All primers were designed and purchased from Integrated DNA Technologies and their sequences are listed in Supplementary file 1.
-
bioRxiv - Cell Biology 2020Quote: ... The chondrocytes were incubated with the dye at 37°C for 2 hours at 300 rpm in a ThermoMixer C (Eppendorf, Hamburg, Germany). After incubation ...
-
bioRxiv - Cell Biology 2020Quote: ... we centrifuged the crude lysate at 500 g for 5 min at 4°C in a microfuge (Eppendorf, model 5424R) to remove cell debris ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Homogenates were centrifuged at 1000 rpm for 5 min at 4°C in a table centrifuge (5424 R, Eppendorf, Germany). The supernatant was transferred to a new tube and again centrifuged at 4°C for 5 min at 1400 rpm ...
-
bioRxiv - Systems Biology 2023Quote: ... Homogenized islets were filtered with 30 µm filter (CellTrics, Sysmex) and pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 400 µL of sort buffer (1% fatty acid-free BSA ...
-
bioRxiv - Systems Biology 2023Quote: ... were added without disturbing the pellet and nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Supernatant was gently removed without disturbing the pellet and leaving ∼2-3 µl behind ...
-
bioRxiv - Systems Biology 2023Quote: ... and incubated on ice for 1 min before pelleting with a swinging-bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Supernatant was gently removed and ∼50 µl were left behind to increase nuclei recovery ...
-
bioRxiv - Pathology 2023Quote: ... The samples were extracted overnight at 4℃ and then centrifuged at 4,000 rpm for 5 min at 4°C using a 5810 R fixed-angle rotor centrifuge (Eppendorf, Germany). 1 ml of the upper layer of petroleum ether was dried under vacuum in a new 2-ml tube ...
-
bioRxiv - Plant Biology 2021Quote: ... samples were centrifuged (20 min, 15,000g, 4°C, in an Eppendorf 5810R centrifuge ...
-
bioRxiv - Genomics 2021Quote: ... and held at 4 C° using the Mastercycler Nexus (Eppendorf, Australia). This was then cycled a total of 40 times ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and centrifuged at 13 000 rpm/15 minutes/4°C (Eppendorf Centrifuge 5415R ...
-
bioRxiv - Neuroscience 2023Quote: ... and 10,000 × g at 4 °C for 30 min (Eppendorf 5910R). Pre-cleared supernatants were subjected to ultracentrifugation at 29,000 rpm using a Beckman SW40 Ti rotor (RCFavg ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were immediately cooled on ice and centrifuged for 12 min at 4°C and 3700 rpm (Centrifuge 5920 R, S-4×1000, Eppendorf). The cell pellets were stored at −20°C until RNA extraction.
-
bioRxiv - Microbiology 2021Quote: ... The cells were transferred into anaerobic 50 mL reaction tubes inside the anaerobic chamber and harvested outside of the anaerobic chamber for 12 min at 4°C and 3700 rpm (Centrifuge 5920 R, S-4×1000, Eppendorf). The supernatant was discarded inside the anaerobic chamber and the pellet was resuspended in fresh RCM medium to an OD600 of 5-10 ...
-
bioRxiv - Bioengineering 2019Quote: For extract preparation each 4 mL of cell cultures from tp 48h of HDC run 1 were spun down for 10 min at 4000 g and 4 °C (Centrifuge 5804R, Rotor A-4-44, Eppendorf). Pellets were resuspended in fresh 1 mL ‘thylakoid buffer’ (50 mM HEPES-NaOH ...
-
bioRxiv - Developmental Biology 2023Quote: ... the gRNA:Cas9 ribonucleoprotein complex solution was incubated at 37°C for 5 min and then backfilled into 3 microinjection needles using an Eppendorf GELoader tip (Eppendorf, Cat# 022351656). After loading embryos into the embryo holder which covered with 12.5 ppt of salinity water with 0.0001% of methylene blue ...
-
bioRxiv - Biophysics 2022Quote: ... The lysate was incubated for 30 min on a rotating wheel at 4°C and centrifuged at 16 000 g for 20 min at 4°C (Eppendorf centrifuge 5417-R, Rotor F45-30-11). The supernatant was transferred to a fresh 1.5 ml Eppendorf tube and the pellet was discarded ...
-
bioRxiv - Physiology 2021Quote: ... These were then incubated at 70°C at 1400 rpm for 2 hours on a heat shaker (Eppendorf) and spun at 2500 x g for 5 min ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were thawed shortly before mass spectrometric analysis and shaken for 2 minutes at 2000rpm (thermomixer C, Eppendorf). Peptide concentrations were measured optically at 280nm (Nanodrop 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... the pellet was hydrolyzed in 3N HCl for 2 hours at 95 °C on a shaking Thermomixer (Eppendorf). The reaction was quenched with 100 % methanol containing 40 μM L-norvaline (as an internal control) ...
-
bioRxiv - Microbiology 2024Quote: ... The stationary pre-cultures were then pooled and washed by centrifugation (5 min, 3,220 g and 4 °C) using a 5810 R swing-out centrifuge (Eppendorf, Hamburg, Germany). After centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... Pellets were washed with cold 70% ethanol and centrifuged at 19,000 × g for 5 min at 4°C and air dried for 15 min in the Centrifugal Vacuum Concentrator 5301 (Eppendorf, USA). The quality of RNA was assessed using a NanoDrop (ND-1000 ...
-
bioRxiv - Immunology 2022Quote: ... Cells were washed with 500μl of D-PBS and centrifuged at 400xg for 10 minutes at room temperature (Eppendorf Centrifuge 5810R, rotor A-4-62). The supernatant was removed and the cell pellet resuspended in 50μl of D-PBS before being stained with CD20-PE (clone A1SB12 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 30-70 kDa lane portions were excised into 2×2 mm cubes and transferred to Protein Lo-Bind tubes (Eppendorf). Excised gels were partitioned into tubes ...
-
bioRxiv - Neuroscience 2022Quote: ... Tissues were fixed in 2% paraformaldehyde for 55 minutes at room temperature in 2 mL Protein LoBind tubes (Eppendorf 022431064). Fixative was removed and tissues were washed 4x 10 minutes with 1.5 mL PBS with 0.5% Triton X-100 (PBT) ...
-
bioRxiv - Systems Biology 2022Quote: ... Samples were held at 4°C and shaken for 10 min at 1000rpm (Eppendorf ThermoMixer C), incubated at -20°C before being centrifuged for 15 min at 11000g and 4 oC ...