Labshake search
Citations for Eppendorf :
201 - 250 of 1404 citations for 7H Pyrrolo 2 3 d pyrimidin 2 amine 7 3 5 bis O 2 4 dichlorophenyl methyl 2 C methyl b D ribofuranosyl 4 chloro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... Next the spheroplasted cells were centrifuged at 1500 rpm for 2 min (Eppendorf centrifuge), the supernatant was removed and the cells were resuspended in 400 µL of breaking buffer which contained 10 mM Tris ...
-
bioRxiv - Plant Biology 2020Quote: ... and these pieces were kept in separate 2 mL low protein binding tubes (Eppendorf). Afterwards ...
-
bioRxiv - Cancer Biology 2020Quote: ... Peptides were concentrated for 2 h in a vacuum concentrator (Eppendorf Vacuum Concentrator plus) at 30°C and diluted to 100 µL with H2O ...
-
bioRxiv - Genomics 2020Quote: ... Acceleration and deceleration were set to 2 across all centrifugations (Eppendorf centrifuge 5804, Eppendorf). Plasma was aliquoted per 1500 µL and stored at -80°C until further processing.
-
bioRxiv - Genomics 2020Quote: ... Acceleration and deceleration were set to 2 across all centrifugations (Eppendorf centrifuge 5804, Eppendorf). Plasma was aliquoted per 1500 µL and stored at -80°C until further processing.
-
bioRxiv - Neuroscience 2020Quote: ... The samples were then centrifuged at 1600 rpm for 2 min (Eppendorf 5415R, 200xg) and the supernatant aspirated before the tissue was incubated in a collagenase solution containing 2 mg/mL collagenase type II (CLS2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15.76 g EDTA (pH 8)) in 2 mL Safe-Lock tubes (Eppendorf, Hamburg, Germany). The QIAamp DNA Mini Kit (QIAGEN ...
-
bioRxiv - Physiology 2022Quote: Sperm were concentrated by pipetting 2 mL sperm water into a microcentrifuge tube (Eppendorf), followed by centrifugation at 1500 x g for 5 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... The aqueous layer was transferred into a 2 ml phase lock gel tube (Eppendorf) and mixed with 750 μl chloroform (Roth ...
-
bioRxiv - Neuroscience 2023Quote: ... each half cortex was frozen in low-bind 2-ml Eppendorf tubes (Eppendorf, 0030108132) prior to addition of 500 μl of 0.32 M Sucrose Solution (0.32 M sucrose (SLS ...
-
bioRxiv - Neuroscience 2023Quote: ... All lipid extractions were performed in 2 mL polypropylene LoBind safe-lock tubes (Eppendorf).
-
bioRxiv - Bioengineering 2024Quote: ... placed in individual nuclease-free 2 mL centrifuge tubes (DNA LoBind® Tubes, Eppendorf) and homogenized using a rotor-stator homogenizer (TissueMiser ...
-
bioRxiv - Biochemistry 2024Quote: ... The sample was collected in a 2 mL round bottom tube (Eppendorf, Hamburg, Germany) centrifuged for 5 mins ...
-
bioRxiv - Microbiology 2024Quote: ... We transferred the resulting suspension to a 2 ml Safe-Lock tube (Eppendorf 0030123620) and mechanically disrupted the samples using a TissueLyser LT (Qiagen 85600 ...
-
bioRxiv - Bioengineering 2023Quote: ... Transwells® were then incubated at 37 °C and 25 RPM for 2 hrs in a New Brunswich™ Innova® 40 shaker (Eppendorf, Enfield, CT). Samples were collected every hour from the basolateral side ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2019Quote: ... The lysate was centrifuged at 4°C at 3220 g for 15 min (Eppendorf #A-4-81 rotor) to remove intact cells and debris ...
-
bioRxiv - Synthetic Biology 2022Quote: The concentration and quality of the plasmid solutions were determined by diluting 1 ul of plasmid solution in 4 ul of Tris EDTA buffer and loading 3 ul of the diluted solution on a μCuvette G1 (Eppendorf). Optical densities were measured at 260 nm and 280 nm using a BioSpectrophotometer and Fluorimeter (Eppendorf) ...
-
bioRxiv - Neuroscience 2020Quote: ... for 30 min at 4°C on centrifuge (Eppendorf #5804R) and rotor (Eppendorf #S-4-72) ...
-
bioRxiv - Physiology 2023Quote: ... for 1 h at 4 □ on a ThermoMixer C (Eppendorf), 350 µl of water and 250 µl of chloroform were added to the mixture to induce phase separation ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by high-speed centrifugation (4°C, 12000rpm, Eppendorf, 5424R) for 20 minutes to collect the protein supernatant ...
-
bioRxiv - Immunology 2021Quote: ... The culture supernatant containing the virus was centrifuged at 4,500 g for 5 min at 4°C (Eppendorf 5810R) and stored at -80°C ...
-
bioRxiv - Genomics 2021Quote: ... 0.6 mM DTT) and pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Pulverized frozen tissue and pelleted nuclei from gentleMACS M-tubes were each split into two further aliquots ...
-
bioRxiv - Neuroscience 2020Quote: ... Isolated brain nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei pellets were resuspended in 1 ml nuclei permeabilization buffer (5 % BSA ...
-
bioRxiv - Genomics 2019Quote: ... Cells were thawed and pelleted in a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Cell pellets were resuspended in 250 μl nuclei permeabilization buffer (10 mM Tris-HCl pH 7.4 (Sigma) ...
-
bioRxiv - Genomics 2019Quote: ... Isolated brain nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei pellets were resuspended in 1 ml nuclei permeabilization buffer (5 % BSA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were put on ice for 30 min and precipitates were spun down for 5 min at 20,000 g at 4°C in a tabletop centrifuge (Eppendorf). After one wash with ice-cold acetone ...
-
bioRxiv - Microbiology 2023Quote: ... OD660 of 0.3-0.5 mid-log) were harvested by centrifugation (5,000 x g, 5 min at 4°C) (Eppendorf centrifuge 5430R). The supernatant was immediately discarded ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Cycling amplification was carried out in a Mastercycler® RealPlex 2 thermocycler (Eppendorf, Hamburg, Germany) with the following amplification program ...
-
bioRxiv - Biochemistry 2021Quote: ... and transferred into pre-chilled Protein LoBind® 2 mL microtubes (Eppendorf AG, Hamburg, Germany). The cells were pelleted by low-speed centrifugation at 800×g for 3 min at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... and 100 mg of freeze-dried tissue was transferred to 2-ml microcentrifuge tubes (Eppendorf Safe-Lock tubes ...
-
bioRxiv - Cancer Biology 2022Quote: ... (2×105 total) Labelling reactions were carried out in DNA LoBind® tubes (Eppendorf, 0030108051) using 5 mM N3-kethoxal (a gift from Chuan He ...
-
bioRxiv - Biochemistry 2021Quote: ... Unbound lysate was removed and the Dynabeads transferred to 2 ml LoBind protein tubes (Eppendorf). Beads were washed five times with 2% SDS wash buffer (150 mM NaCl ...
-
bioRxiv - Genomics 2021Quote: ... 2 mL of cells were aliquoted to a 15 mL conical and centrifuged (Eppendorf 5424R) at 500 g for 5 min ...
-
bioRxiv - Microbiology 2021Quote: ... The surface sterilized root sections were transferred into clean 2-ml Safe-lock tubes (Eppendorf) with stainless steel beads and 200 ul of wash buffer ...
-
bioRxiv - Microbiology 2022Quote: ... The tip of one swab was broken off into a 2 ml tube (BioPur, Eppendorf) and snap frozen in dry-ice and stored at −80°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Each biopsy was placed in a 2 ml DNA LoBind tube (Eppendorf, Fisher Scientific, UK) containing 1 ml of molecular grade 100% ethanol (Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... 30 mg (fresh weight) were weighed into 2 ml safe lock tubes (Eppendorf AG, Germany) and kept at -80°C until analysis ...
-
bioRxiv - Microbiology 2022Quote: ... 1 ml of the lung homogenate was added to 2 ml DNA LoBind tubes (Eppendorf) alongside 500 µl sterile killing buffer (20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Genomics 2023Quote: ... an aliquot of this sperm was transferred to a 2 mL DNA LoBind microtube (Eppendorf) for immediate DNA extraction and general evaluation using a hemocytometer ...
-
bioRxiv - Microbiology 2023Quote: ... The remaining roots were put into a 2- ml safe-lock tube (Eppendorf, Hamburg, Germany) and stored at −20°C ...
-
bioRxiv - Microbiology 2023Quote: ... body and saliva samples were collected in 2-mL safe-Lock tubes (Eppendorf, Hamburg, Germany) with 300 ...
-
The conserved membrane-proximal domain of Sbh1/ Sec61β guides signal peptides into the Sec61 channelbioRxiv - Biochemistry 2024Quote: ... Cells (2 OD600) were harvested at 600 x g for 1 min (MiniSpin Centrifuge, Eppendorf) and the supernatants were discarded ...
-
bioRxiv - Microbiology 2024Quote: ... The mixture was centrifugated at 12000 rpm for 2 min (MiniSpin centrifuge, Eppendorf, Hamburg, Germany). The supernatant was transferred to a LC vial.
-
bioRxiv - Biochemistry 2020Quote: ... polar phase were transferred into a new 2 mL reaction tube and dried in a vacuum concentrator (Eppendorf, Concentrator plus, mode: V-AQ, 30 °C) for approximately 4.5 h ...
-
bioRxiv - Neuroscience 2023Quote: ... They were then resuspended to a concentration of ∼800-3000 nuclei per uL across 3-4 x twin.tec™ 96 Well LoBind PCR Plates (Eppendorf, 0030129512) in NSB ...
-
bioRxiv - Cell Biology 2020Quote: ... we centrifuged the crude lysate at 500 g for 5 min at 4°C in a microfuge (Eppendorf, model 5424R) to remove cell debris ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Homogenates were centrifuged at 1000 rpm for 5 min at 4°C in a table centrifuge (5424 R, Eppendorf, Germany). The supernatant was transferred to a new tube and again centrifuged at 4°C for 5 min at 1400 rpm ...
-
bioRxiv - Systems Biology 2023Quote: ... Homogenized islets were filtered with 30 µm filter (CellTrics, Sysmex) and pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 400 µL of sort buffer (1% fatty acid-free BSA ...
-
bioRxiv - Systems Biology 2023Quote: ... were added without disturbing the pellet and nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Supernatant was gently removed without disturbing the pellet and leaving ∼2-3 µl behind ...