Labshake search
Citations for Eppendorf :
51 - 100 of 840 citations for 7H Diimidazo 1 5 a 1 5 4 de quinoxaline 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... Cells were thawed and pelleted in a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Cell pellets were resuspended in 250 μl nuclei permeabilization buffer (10 mM Tris-HCl pH 7.4 (Sigma) ...
-
bioRxiv - Genomics 2019Quote: ... Isolated brain nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei pellets were resuspended in 1 ml nuclei permeabilization buffer (5 % BSA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were put on ice for 30 min and precipitates were spun down for 5 min at 20,000 g at 4°C in a tabletop centrifuge (Eppendorf). After one wash with ice-cold acetone ...
-
bioRxiv - Cell Biology 2022Quote: ... protease and phosphatase inhibitors and PMSF (10 minutes on ice) and centrifuged at 13,300 rpm for 5 min at 4OC (Centrifuge 5810 R; rotor A-4-81; Eppendorf). The supernatant (whole cell lysates ...
-
bioRxiv - Microbiology 2023Quote: ... OD660 of 0.3-0.5 mid-log) were harvested by centrifugation (5,000 x g, 5 min at 4°C) (Eppendorf centrifuge 5430R). The supernatant was immediately discarded ...
-
bioRxiv - Bioengineering 2021Quote: ... CsupADH_17286 and HzeaADH7 were introduced into Agrobacterium tumefaciens GV3101 strain (MP90RK) by electroporation (1700 V mm-1, 5 ms, Eppendorf 2510). A viral silencing suppressor protein P19 was introduced into GV3101 strain as well in order to inhibit the host cells’ transgene silencing apparatus and extend transgene expression over a longer period of time with a higher degree of expression (Canto et al ...
-
bioRxiv - Cell Biology 2023Quote: ... or at 37°C/5% CO2/1% O2 in a nitrogen-controlled hypoxic incubator (New Brunswick Galaxy 170R, Eppendorf, Hamburg, Germany). Prior to media changes ...
-
bioRxiv - Cell Biology 2020Quote: ... we centrifuged the crude lysate at 500 g for 5 min at 4°C in a microfuge (Eppendorf, model 5424R) to remove cell debris ...
-
bioRxiv - Cell Biology 2022Quote: ... Absorbance was measured at 600 nm after every 12 h intervals till 4 to 5 days using a UV-visible spectrophotometer (Eppendorf).
-
bioRxiv - Cell Biology 2021Quote: ... was harvested by centrifugation at 300 × g for 5 min in a swing out 5804 S-4-72 rotor (Eppendorf). Baculovirus infected insect cell (BIIC ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Homogenates were centrifuged at 1000 rpm for 5 min at 4°C in a table centrifuge (5424 R, Eppendorf, Germany). The supernatant was transferred to a new tube and again centrifuged at 4°C for 5 min at 1400 rpm ...
-
bioRxiv - Systems Biology 2023Quote: ... Homogenized islets were filtered with 30 µm filter (CellTrics, Sysmex) and pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 400 µL of sort buffer (1% fatty acid-free BSA ...
-
bioRxiv - Systems Biology 2023Quote: ... were added without disturbing the pellet and nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Supernatant was gently removed without disturbing the pellet and leaving ∼2-3 µl behind ...
-
bioRxiv - Bioengineering 2023Quote: ... The resulting injection micropipette was backfilled with 5-10 μL of 500 μg/mL fluorescein solution and was mounted on the microinjection manipulator (InjectMan 4, Eppendorf) connected to a pneumatic microinjection pump (FemtoJet 4i ...
-
bioRxiv - Pathology 2023Quote: ... The samples were extracted overnight at 4℃ and then centrifuged at 4,000 rpm for 5 min at 4°C using a 5810 R fixed-angle rotor centrifuge (Eppendorf, Germany). 1 ml of the upper layer of petroleum ether was dried under vacuum in a new 2-ml tube ...
-
bioRxiv - Cell Biology 2023Quote: ... is harvested by centrifugation at 300 × g for 5 min in a swing out 5804 S-4-72 rotor (Eppendorf). P1 virus was used to infect 50 ml of SF9 culture and P2 virus was harvested after 3-5 days through centrifugation and subsequent filtration through 0.45 μm PVDF membrane (Merck Millipore ...
-
bioRxiv - Microbiology 2019Quote: ... and extension at 72°C for 1 min followed by final extension was conducted at 72°C for 5 min using a PCR minicycler (Eppendorf Ltd., Germany). After amplification ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial mixtures were diluted 1:1000 into LB with or without 1% DMSO (v/v) and incubated standing at 37°C in 5% CO2 at atmospheric oxygen (normoxic; Eppendorf CellXpert incubator), 1% oxygen (hypoxic ...
-
bioRxiv - Immunology 2020Quote: Using 5 mL lo-bind tubes (Eppendorf), 960 μL of ice-cold methanol was added to ~1 mL of protein supernatant and vortexed briefly before subsequent addition of 160 μL of ice-cold chloroform and thorough mixing ...
-
bioRxiv - Neuroscience 2024Quote: ... placed in 5-ml tubes (Eppendorf, 0030119452) and dehydrated 1h in each methanol baths (50% ...
-
bioRxiv - Physiology 2023Quote: ... for 1 h at 4 □ on a ThermoMixer C (Eppendorf), 350 µl of water and 250 µl of chloroform were added to the mixture to induce phase separation ...
-
bioRxiv - Biophysics 2019Quote: ... 6 mL of the selection culture in 2 mL centrifuge tubes was pelleted at 5000 rpm for 5 minutes at 4°C in a microcentrifuge (Eppendorf, 5242R). The supernatant was removed except for the last ∼200 µL ...
-
bioRxiv - Microbiology 2024Quote: ... Pellets were washed with cold 70% ethanol and centrifuged at 19,000 × g for 5 min at 4°C and air dried for 15 min in the Centrifugal Vacuum Concentrator 5301 (Eppendorf, USA). The quality of RNA was assessed using a NanoDrop (ND-1000 ...
-
bioRxiv - Microbiology 2024Quote: ... The stationary pre-cultures were then pooled and washed by centrifugation (5 min, 3,220 g and 4 °C) using a 5810 R swing-out centrifuge (Eppendorf, Hamburg, Germany). After centrifugation ...
-
bioRxiv - Bioengineering 2022Quote: ... Subsequent washes were performed at a volume of 5 mL in 5 mL Eppendorf tubes (Cat. No. 0030122321, Eppendorf) and pelleted with a compatible microcentrifuge (MC-24™ Touch ...
-
bioRxiv - Microbiology 2019Quote: ... in a 5 mL tube (Eppendorf, Hamburg, Germany). Tubes were kept as cold as possible while in the field (usually for less than 8 h ...
-
bioRxiv - Developmental Biology 2019Quote: ... at 5% CO2 (Eppendorf® New Brunswick Galaxy170S). Media was changed every day and cells were passaged upon reaching 80% confluence ...
-
bioRxiv - Cell Biology 2019Quote: ... shaked for 5 min on a thermomixer (Eppendorf) at room temperature and centrifuged for 20 min at 4°C full speed ...
-
bioRxiv - Microbiology 2023Quote: ... vortexed for 5 min and then centrifuged (Eppendorf Centrifuge model 5810 R ...
-
bioRxiv - Microbiology 2023Quote: ... centrifuging for 5 min at 7,500 rcf (Eppendorf, tabletop centrifuge MiniSpin plus with rotor F-45-12-11) ...
-
bioRxiv - Cell Biology 2020Quote: ... and the cells were pelleted by centrifugation at approximately 250 × g for 5 min at 4 °C (Eppendorf 5804 R, Hamburg, Germany). After resuspension ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Master Cycler Pro Device (EPPE6324000.516, Eppendorf, DE). For RT-qPCR ...
-
bioRxiv - Cell Biology 2020Quote: ... 5000 rpm for 5 min in 5415D centrifuge (Eppendorf) to remove aggregates.
-
bioRxiv - Genomics 2022Quote: ... typically a 5 mL Lo-bind tube (0030122348, Eppendorf) or 15 mL falcon tube (229410 ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were pooled in 5 mL LoBind tubes (Eppendorf) in 1 mL chilled lysis buffer (10 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2024Quote: ... centrifuged at 1200 RPM for 5 minutes (Eppendorf 5180) and stained for cell viability using Fixable Live/Dead Blue for 30 min at 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were spun down (5 min, 800 g•, 2 °C, minimal acceleration and break, Eppendorf 5810 R with swing-×bucket rotor A-4-44). The medium was discarded and the cells were dissociated in 15 mL of ice cold ACK solution (0.15 M NH4Cl ...
-
bioRxiv - Bioengineering 2019Quote: For extract preparation each 4 mL of cell cultures from tp 48h of HDC run 1 were spun down for 10 min at 4000 g and 4 °C (Centrifuge 5804R, Rotor A-4-44, Eppendorf). Pellets were resuspended in fresh 1 mL ‘thylakoid buffer’ (50 mM HEPES-NaOH ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Bioengineering 2019Quote: ... for 5 minutes at 3,500 RPM (2,465 x g, Eppendorf 5810R v3.3 centrifuge with A-4-62 rotor ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Cell Biology 2023Quote: ... in a 5% CO2 containing humidified incubator (Eppendorf Galaxy 170S) at 37°C.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... cells are vigorously mixed in a Mixmate (Eppendorf, Hamburg DE) at 1000 rpm for 2 minutes ...
-
bioRxiv - Neuroscience 2020Quote: We transferred 5 dpf larvae to 1.5 ml centrifuge tubes (Eppendorf). All fish water was aspirated and replaced with 1.0 ml 4% paraformaldehyde (Electron Microscopy Sciences ...