Labshake search
Citations for Eppendorf :
1 - 50 of 1234 citations for 7H Azeto 2 1 b 1 3 dioxino 4 5 e 1 3 oxazin 7 one hexahydro 2 6 dimethyl 2S 4aR 5aS 6S 9aR 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were recovered in 1 mL YPD (1% yeast extract, 2% Bacto peptone, 2% D-glucose) at 30°C in a ThermoMixer C (Eppendorf, Hamburg, Germany) for 3 hours (200 RPM ...
-
bioRxiv - Biochemistry 2019Quote: ... Dilutions (1:2) were performed using EP Motion (Eppendorf) and transferred to cells using the Tecan Freedom Evo ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Cell Biology 2019Quote: ... HeLa SS6 or 1.E cells were seeded into 35 mm tissue culture dishes or 6 well tissue culture plates (Eppendorf) with or without pre-cleaned ...
-
bioRxiv - Bioengineering 2023Quote: ... MPCs were washed twice for 3 min at 400 RCF at room temperature with PBS supplemented with 1% glucose and 1% pen-strep (Eppendorf 5702R, Hamburg, Germany). Biotinylation of the cell surface was performed by adding 1 mM Sulfo-NHS-LC-Biotin (Thermo Fisher ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Biophysics 2020Quote: ... The needle was then glued to a 6×4×2 mm Neodyn magnet (QM-06×04×02-N, Magnets4you) and attached to a motorized micromanipulator (PatchMan, Eppendorf). The magnetic needle was lowered until it touched the bottom of a dummy sample dish and raised again so that it was placed above the bottom of the sample with the very tip in focus around 100 μm above the focus of the glass surface.
-
bioRxiv - Microbiology 2022Quote: ... 1 ml of the lung homogenate was added to 2 ml DNA LoBind tubes (Eppendorf) alongside 500 µl sterile killing buffer (20 mM Tris-HCl pH 7.5 ...
-
The conserved membrane-proximal domain of Sbh1/ Sec61β guides signal peptides into the Sec61 channelbioRxiv - Biochemistry 2024Quote: ... Cells (2 OD600) were harvested at 600 x g for 1 min (MiniSpin Centrifuge, Eppendorf) and the supernatants were discarded ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 1-5 intact Hydra polyps were incubated per well in a flat bottom 6-well plate (Eppendorf, Hamburg, Germany) filled with 8mL of HM or respective anesthesia ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and sonicated in chilled PBS (1 s on ...
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mixture was sonicated 3 times for 1 minute in a waterbath sonicator and incubated in a ThermoMixer (Eppendorf) for 30 minutes at 37°C and 500 rpm ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... nine 1 mL aliquots were centrifuged for 2 min at 2500 rcf (Eppendorf, Centrifuge 5424 R) and the MOPS-based supernatant removed ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Biophysics 2022Quote: ... the DNA droplet-containing aqueous phase was layered on top of the oil phase in a volumetric ratio of 1:3 within a microtube (Eppendorf). For the segregation of DNA droplets using enzymatic activity ...
-
bioRxiv - Biophysics 2022Quote: ... The aqueous solution was layered on top of the oil-surfactant mix in a volumetric ratio of 1:3 inside a microtube (Eppendorf). The tube was manually shaken for about 30 s until water-in-oil droplets formed ...
-
bioRxiv - Biophysics 2020Quote: ... the DNA-containing aqueous phase was layered on top of the oil phase in a volumetric ratio of 1:3 within a microtube (Eppendorf). Droplet formation was induced by manual shaking for about 4 s as described earlier.[26] For the oil-phase ...
-
bioRxiv - Genomics 2024Quote: ... and washed in nuclease-free H2O before proceeding to MNase digestion with 1-2U of MNase for 3×106 cells that went on for 1-hour at 37C while shaking in a thermomixer (Eppendorf) at 550rcf ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Neuroscience 2022Quote: ... 1-2 fecal pellets were collected from each mouse by voluntary defecation into a sterile microtube (Eppendorf, Germany) and fecal samples were immediately placed on dry ice ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... pH 7.6) and injected into 1 to 2-cell-stage embryos by using a microinjector FemtoJet 5247 (Eppendorf). The sequences and the concentrations of MOs (Gene Tools ...
-
bioRxiv - Biophysics 2019Quote: ... 6 mL of the selection culture in 2 mL centrifuge tubes was pelleted at 5000 rpm for 5 minutes at 4°C in a microcentrifuge (Eppendorf, 5242R). The supernatant was removed except for the last ∼200 µL ...
-
bioRxiv - Microbiology 2022Quote: ... The tip of one swab was broken off into a 2 ml tube (BioPur, Eppendorf) and snap frozen in dry-ice and stored at −80°C ...
-
bioRxiv - Plant Biology 2024Quote: ... SDS at a 1:3 (w/v) ratio and extracted by shaking 1000 RPM 95 °C for using a tabletop shaker (Eppendorf ThermoMixer F2.0). Samples were then centrifuged at 20,000 xg for 10 min at room temperature and the supernatant retained in new tubes ...
-
bioRxiv - Systems Biology 2023Quote: ... and incubated on ice for 1 min before pelleting with a swinging-bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Supernatant was gently removed and ∼50 µl were left behind to increase nuclei recovery ...
-
bioRxiv - Genomics 2022Quote: ... Beads and proteins were incubated for 3 hours at 4°C (Eppendorf ThermoMixer, 1,300 rpm). Beads were then washed four times with lysis buffer and recovered in 40 µl of laemmli buffer (50 mM Tris-Cl pH 6.8 ...
-
bioRxiv - Physiology 2023Quote: ... for 1 h at 4 □ on a ThermoMixer C (Eppendorf), 350 µl of water and 250 µl of chloroform were added to the mixture to induce phase separation ...
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Immunology 2022Quote: ... For that 2.5x105 cells were incubated with HIV-1 antigens in PBS/2% FCS for the indicated period of times on a 37°C thermomixer (Eppendorf). Cells were then fixed with IC fixation buffer on ice for 30 mins and at RT for additional 30 mins ...
-
bioRxiv - Molecular Biology 2022Quote: ... Destained gel bands were first cut into small cubes (1-2 mm in each dimension) using a clean scalpel and transferred to new LoBind tubes (Eppendorf). Gel cubes were dehydrated by incubating in 500 μL acetonitrile (ACN ...
-
bioRxiv - Genetics 2022Quote: ... Fractions were collected every three minutes, and fractions were pooled in two passes (1 + 17, 2 + 18 … etc.) and dried in a Speed-Vac (Eppendorf).
-
bioRxiv - Microbiology 2023Quote: ... the mucin beads sampled from different time points were first washed with 1 ml filter-sterilized PBS in 2-ml tubes (Eppendorf). After carefully removing the supernatant ...
-
bioRxiv - Plant Biology 2023Quote: ... benthamiana leaf tissue 5-days post Agrobacterium infiltration was collected using a leaf disc cutter 1 cm in diameter and placed inside a 2 mL safe-lock tube (Eppendorf). Each biological replicate consisted of 4 leaf discs from the same leaf (approximately 40 mg fresh weight) ...
-
bioRxiv - Cell Biology 2022Quote: ... Fractions were collected every three minutes, pooled in two passes (fraction 1 + 17, fraction 2 + 18,…, etc.) and dried in a vacuum centrifuge (Eppendorf).
-
bioRxiv - Cell Biology 2022Quote: ... Fractions were collected every three minutes, and fractions were pooled in two passed (1 + 17, 2 + 18 … etc.) and dried in a vacuum centrifuge (Eppendorf). Dried fractions were resuspended in 0.1% formic acid and analyzed on a Orbitrap Lumos Tribrid mass spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Fractions were collected every three minutes, and fractions were pooled in two passes (1 + 17, 2 + 18 … etc.) and dried in a vacuum centrifuge (Eppendorf). Dried fractions were re-suspended in 0.1% formic acid (FA ...
-
bioRxiv - Developmental Biology 2024Quote: ... One nL morpholino (dissolved in 0.2 M KCl with 0.05% phenol red at 3 mg/mL) was microinjected into haploid embryos at the 1 or 2-cell stage using FemtoJet and InjectMan NI2 (Eppendorf).
-
bioRxiv - Microbiology 2023Quote: Overnight cultures of the investigated strains were prepared in 1 mL aliquots of TSB in 2 mL microcentrifuge tubes (Eppendorf) which were incubated horizontally with shaking (120 rpm ...