Labshake search
Citations for Eppendorf :
451 - 500 of 1281 citations for 7 Hydroxy 2 3 dihydro 1H cyclopenta c chromen 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... a volume of 100 µL 40 mM DTT(aq) was added and incubated for 20 min at 56 °C and 300 rpm on a ThermoMixer C (Eppendorf, Hamburg, Germany). After centrifugation at 14,000 x g for 10 min ...
-
bioRxiv - Systems Biology 2024Quote: ... are then added to the sample and incubated at 56°C for 1 hour at 1000 RPM (ThermoMixer C, Eppendorf, Hamburg, Germany). 37µl of 500mM chloroacetamide (50mM final concentration ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... then boiled 10 min at 95 °C (Mastercycler, Eppendorf) and cooled in ice water ...
-
bioRxiv - Systems Biology 2019Quote: ... and boiled (90°C, 90min) in a ThermoMixer (Eppendorf) using a 96-well adapter ...
-
bioRxiv - Systems Biology 2020Quote: ... pelleted in a tabletop centrifuge (Centrifuge 5417 C, Eppendorf) at 10,000 xg for 30 s ...
-
bioRxiv - Biophysics 2021Quote: ... shaken at 37°C (Innova S44i, Eppendorf, Hamburg, Germany) until an OD600 of 0.6 ...
-
bioRxiv - Microbiology 2022Quote: ... was added and incubated in a thermomixer C (Eppendorf) for 90 min at 30°C and 1400 rpm ...
-
bioRxiv - Neuroscience 2020Quote: ... and put on a heating block (Thermomixer C, Eppendorf) at 37 °C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... then boiled 10 min at 95 °C (Mastercycler, Eppendorf) and cooled in ice water ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... at 37°C under stirring (750 RPM, Thermomixer, Eppendorf). At indicated times ...
-
bioRxiv - Biochemistry 2023Quote: ... Devices used were: thermo shaker (ThermoMixer C) from Eppendorf, Hamburg ...
-
bioRxiv - Molecular Biology 2023Quote: ... mixed it by plate mixer (ThermoMixer® C, Eppendorf) at 2000 rpm for 1 min at room temperature and incubated for 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... mixed it by plate mixer (ThermoMixer® C, Eppendorf) at 2000 rpm for 1 min at room temperature and incubated for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... was added and incubated in a thermomixer C (Eppendorf) for 90 min at 30°C and 1400 rpm ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was added and incubated in a thermomixer C (Eppendorf) for 90 min at 30 °C and 1400 rpm ...
-
bioRxiv - Neuroscience 2024Quote: ... incubated in agitation (300rpm) in a ThermoMixer C (Eppendorf) for 30 min at 35C and sonicated again as previously ...
-
bioRxiv - Developmental Biology 2019Quote: ... was injected at a concentration of 40 mM in embryos either at the end of cellularization around 5 min before imaging or at stage 7 during imaging using an InjectMan4 micromanipulator and a FemtoJet 4i microinjector from Eppendorf directly installed on the imaging microscope.
-
bioRxiv - Evolutionary Biology 2023Quote: ... and InjectMan NI 2 (Eppendorf). Cas9 protein (500 ng/μL) ...
-
bioRxiv - Developmental Biology 2019Quote: ... We have determined that one critical parameter in this process is the use of low-retention 1.5 ml microcentrifuge tubes (e.g., Eppendorf DNA LoBind tubes ...
-
bioRxiv - Immunology 2020Quote: ... The complementary DNA was catalyzed by incubating the samples at 25°C (10min) and 50°C (50min) in a PCR thermal cycler (Mastercycler X59s, Eppendorf, Hauppauge, NY, USA). The reaction was inactivated at 70°C for 15 min and allowed to cool at 4°C for 10min ...
-
bioRxiv - Microbiology 2020Quote: ... printed arrays were moved to individual 1 mL centrifuge tubes containing 200 μL of M9 medium and melted at 55°C for 1 min in a thermomixer (Eppendorf ThermoMixer® C) shaking at 1000 rpm ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5 μL RNase A (10mg/mL) was added to each sample and incubated for 30 minutes at 37°C on an Eppendorf ThermoMixer C (Eppendorf AG, Hamburg, Germany). Subsequently ...
-
bioRxiv - Plant Biology 2023Quote: ... ice-cold aqueous methanol by promptly vortexing and subsequent thermal incubation (800 rpm, 80°C, 15 min) in the ThermoMixer® C (Eppendorf, Hamburg, Germany). After centrifugation (16000 x g ...
-
bioRxiv - Cell Biology 2022Quote: ... and InjectMan®4 micromanipulator (Cat#. 5192000035, Eppendorf) using external continuous pressure ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 mM Ammonium bicarbonate pH 8.0 and 5 mM DTT) was added to each RNAse eluent which were denatured at 45 °C for 30 min with gentle shaking (Eppendorf, Thermomixer C, 800 rpm). Samples were centrifuged at 5,000 g for 1 min and cooled to room temperature ...
-
bioRxiv - Genetics 2021Quote: ... 72°C 45 s and a final extension at 72°C for 5 min was run on an Eppendorf Mastercycler® (Eppendorf AG, Hamburg Germany). Amplicons were observed on a 1.5% agarose gel (Bioline (Aust ...
-
bioRxiv - Genomics 2020Quote: The ST slide with the tissue section was warmed to 37°C for 1 minute on a thermal incubator (Eppendorf Thermomixer Option C, Germany). The tissue was then covered with 4% formaldehyde (Sigma-Aldrich ...
-
bioRxiv - Genomics 2021Quote: ... and incubated for 60 min at 37°C with light mixing at 300 rpm using the Eppendorf ThermoMixer® C (Eppendorf, Cat. No.: 2231000680). Subsequently ...
-
bioRxiv - Biochemistry 2022Quote: ... Silicone/PTFE) and added to a preheated thermal mixer (80°C) with a 96 SmartBlock™ DWP 1000n attachment (Thermomixer C, Eppendorf Ltd., Stevenage, UK) for 15 min at 1500 rpm to gelatinize the starch ...
-
bioRxiv - Neuroscience 2019Quote: ... for 48 hours at 37°C on a Thermomixer (Eppendorf) at 1050 rpm ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2020Quote: ... for 15 min at 37°C in a Thermomixer (Eppendorf) with gentle agitation (800 rpm) ...
-
bioRxiv - Microbiology 2021Quote: ... incubation at 37°C at 620 nm (BioPhotometer, Eppendorf, Germany). Coated plates were stored (until 24 hrs ...
-
bioRxiv - Cell Biology 2022Quote: ... and agitated (1,300rpm, 30 min, 1°C; Thermomixer Comfort, Eppendorf). Solubilized membrane proteins were obtained in the supernatant from this agitated suspension by centrifugation (21,000g ...
-
bioRxiv - Neuroscience 2019Quote: ... Samples were digested overnight in a 37 °C thermomixer (Eppendorf). For Orbitrap Fusion Tribrid MS analysis ...
-
bioRxiv - Immunology 2019Quote: ... for 1 hour at 37°C in a Thermomixer (Eppendorf) with shaking set at 1000rpm ...
-
bioRxiv - Pathology 2021Quote: ... Reverse transcription was performed on a ThermoMixer® C (Eppendorf) at 1,200 rpm and 37°C for 45 minutes ...
-
bioRxiv - Neuroscience 2019Quote: ... for 10 min at 70°C in a Thermomixer (Eppendorf) at 800 rpm ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were evaporated to dryness at 45 °C (Concentrator, Eppendorf), resuspended in 8 M Urea and reduced with 2.5 mM TCEP ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1,500 RPM on an Eppendorf ThermoMixer C (Eppendorf,Hamburg, Germany).
-
bioRxiv - Cancer Biology 2023Quote: ... and 85°C for 5min with a Mastercycler personal (Eppendorf).
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Neuroscience 2023Quote: ... for 15 min at 37°C in a Thermomixer (Eppendorf) with gentle agitation (800 rpm) ...
-
bioRxiv - Immunology 2023Quote: ... and 60 min at 37°C in a thermomixer (Eppendorf). Immediately after the incubation ...
-
bioRxiv - Bioengineering 2023Quote: ... 30°C in a Innova S44i shaker (Eppendorf, Hamburg, Germany) for 16 hours ...
-
bioRxiv - Bioengineering 2023Quote: ... and further incubated in a thermoshaker (Eppendorf ThermoMixer® C) at 30°C and 350 RPM for 20 minutes to facilitate resuspension ...
-
bioRxiv - Physiology 2024Quote: ... they were incubated at 28°C in a ThermoMixer (Eppendorf) with agitation at 650 rpm for 2 h to allow reduction of disulfide bounds and alkylation of thiol groups by TCEP and chloroacetamide ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 76°C (New Brunswick Innova 44 incubator, Eppendorf, Germany). Cell growth was monitored by turbidity measurements at 600 nm ...
-
bioRxiv - Genomics 2019Quote: ... One µl of this cocktail was added to the PCR mixture and placed in a thermocycler (Eppendorf MasterCycler Pro). Thermocycling settings were as follows ...