Labshake search
Citations for Eppendorf :
1 - 50 of 1162 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... diluted 1:250 in 500ul PBSFBT either ON or for 2h at 32°C in a heating block (ThermoMixer C, Eppendorf) with integrated shaking (350rpm) ...
-
bioRxiv - Biochemistry 2019Quote: ... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
bioRxiv - Systems Biology 2023Quote: ... and incubated on ice for 1 min before pelleting with a swinging-bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Supernatant was gently removed and ∼50 µl were left behind to increase nuclei recovery ...
-
bioRxiv - Neuroscience 2019Quote: ... and lyophilized for 2h in an Eppendorf concentrator (Eppendorf) and stored at −80°C until use.
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Microbiology 2021Quote: ... centrifuged at 7000 RPM for 7 min at 4 °C (Eppendorf model 5804R). The supernatant was discarded ...
-
bioRxiv - Physiology 2023Quote: ... for 1 h at 4 □ on a ThermoMixer C (Eppendorf), 350 µl of water and 250 µl of chloroform were added to the mixture to induce phase separation ...
-
bioRxiv - Genomics 2019Quote: ... incubated for 5 min at 4 °C with rotation and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4°C for 5 minutes (Eppendorf centrifuge 5810 R, Rotor S-4-104). Cell pellets were washed with 5 mL D-PBS and centrifugation was repeated ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were recovered in 1 mL YPD (1% yeast extract, 2% Bacto peptone, 2% D-glucose) at 30°C in a ThermoMixer C (Eppendorf, Hamburg, Germany) for 3 hours (200 RPM ...
-
bioRxiv - Biochemistry 2019Quote: ... Dilutions (1:2) were performed using EP Motion (Eppendorf) and transferred to cells using the Tecan Freedom Evo ...
-
bioRxiv - Biophysics 2019Quote: ... 6 mL of the selection culture in 2 mL centrifuge tubes was pelleted at 5000 rpm for 5 minutes at 4°C in a microcentrifuge (Eppendorf, 5242R). The supernatant was removed except for the last ∼200 µL ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Physiology 2020Quote: ... 1% Antibiotic-Antimycotic] in a 5% CO2 incubator (Galaxy 170R, Eppendorf) at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, Eppendorf #A-4-81 rotor) to remove intact cells and debris ...
-
bioRxiv - Neuroscience 2023Quote: ... The 1 ml of PBS with the resuspended cells was transferred to a 1·5 ml Protein LoBind tube (Eppendorf), centrifuged at 3000 x g for 6 min at 4 °C ...
-
bioRxiv - Bioengineering 2019Quote: For extract preparation each 4 mL of cell cultures from tp 48h of HDC run 1 were spun down for 10 min at 4000 g and 4 °C (Centrifuge 5804R, Rotor A-4-44, Eppendorf). Pellets were resuspended in fresh 1 mL ‘thylakoid buffer’ (50 mM HEPES-NaOH ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were spun down (5 min, 800 g•, 2 °C, minimal acceleration and break, Eppendorf 5810 R with swing-×bucket rotor A-4-44). The medium was discarded and the cells were dissociated in 15 mL of ice cold ACK solution (0.15 M NH4Cl ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1% SDS for 2h at 50°C with shaking at 500rpm using Thermomixer (Eppendorf). Then ...
-
bioRxiv - Bioengineering 2023Quote: ... MPCs were washed twice for 3 min at 400 RCF at room temperature with PBS supplemented with 1% glucose and 1% pen-strep (Eppendorf 5702R, Hamburg, Germany). Biotinylation of the cell surface was performed by adding 1 mM Sulfo-NHS-LC-Biotin (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: ... incubated (1 h) and centrifuged (Eppendorf centrifuge R5810, 4000 rpm for 5 min) for β-galactosidase activity quantification ...
-
bioRxiv - Genomics 2024Quote: ... 1 mL of well-grown culture was centrifuged (5 min, 2040 g; Eppendorf) and the superfluous medium was removed by pipetting ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) to remove intact cells and debris ...
-
bioRxiv - Biochemistry 2020Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, Eppendorf #A-4-81 rotor) and washed with ice-cold 50 mL Binding buffer composed of 10 mM imidazole (pH 7.4) ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBS) and pelleted again (500 × g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Neuroscience 2024Quote: ... samples were centrifuged at 4°C for 5 minutes (Eppendorf 5417R Refrigerated Centrifuge) at 16,400 rpm ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were centrifuged at 4°C for 5 minutes (Eppendorf 5417R Refrigerated Centrifuge) at 16,400 rpm ...
-
bioRxiv - Genomics 2022Quote: ... Beads and proteins were incubated for 3 hours at 4°C (Eppendorf ThermoMixer, 1,300 rpm). Beads were then washed four times with lysis buffer and recovered in 40 µl of laemmli buffer (50 mM Tris-Cl pH 6.8 ...
-
bioRxiv - Microbiology 2022Quote: ... and incubated for 1 h before centrifugation (Eppendorf centrifuge R5810, 4000 rpm for 5 min), followed by quantification of β-galactosidase activity.
-
bioRxiv - Biochemistry 2022Quote: ... 0.01% Tween 20) for 1 h at 4 °C and 1200 rpm in a thermomixer (Eppendorf). Unbound protein was removed by washing 2x with high salt buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Cell Biology 2019Quote: ... The resin was pelleted down by centrifugation at 4°C at 1258 g for 5 min (Eppendorf #A-4-81 rotor) and washed with 25 ml ice-cold binding buffer [10 mM imidazole ...
-
bioRxiv - Biochemistry 2022Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) and washed with ice-cold 50 mL Binding buffer composed of 10mM imidazole (pH 7.4) ...
-
bioRxiv - Immunology 2021Quote: ... lifted cells were centrifuged at 15,000g for 5 minutes at 4°C (Eppendorf 5430R). Cell pellets were placed at −20°C overnight with 60 μL SDS Lysis buffer (1% SDS ...
-
bioRxiv - Genomics 2019Quote: ... in PBS) and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 µL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Microbiology 2022Quote: ... 1 ml of the lung homogenate was added to 2 ml DNA LoBind tubes (Eppendorf) alongside 500 µl sterile killing buffer (20 mM Tris-HCl pH 7.5 ...
-
The conserved membrane-proximal domain of Sbh1/ Sec61β guides signal peptides into the Sec61 channelbioRxiv - Biochemistry 2024Quote: ... Cells (2 OD600) were harvested at 600 x g for 1 min (MiniSpin Centrifuge, Eppendorf) and the supernatants were discarded ...
-
bioRxiv - Biochemistry 2020Quote: ... The rest of the solution was incubated at 4 °C for 1 h on a thermomixer (Eppendorf) set to 1000 rpm ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cell debris was removed via centrifugation at 13,000g for 1 hour at +4°C (Eppendorf 5810r centrifuge). A 1 ml HisTrap FF Crude chromatography column (GE Healthcare ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Biochemistry 2021Quote: ... cell cultures were collected by centrifugation at 3,300 rpm for 3 min at 4°C (using Eppendorf centrifuge 5810R equipped with the A-4-62 rotor ...
-
bioRxiv - Cell Biology 2023Quote: ... the expelled homogenate was palleted by centrifugation for 3 min (at 300 g at 4°C) (Eppendorf). The pellet was discarded ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mixture was sonicated 3 times for 1 minute in a waterbath sonicator and incubated in a ThermoMixer (Eppendorf) for 30 minutes at 37°C and 500 rpm ...
-
bioRxiv - Biochemistry 2020Quote: ... The solution was centrifuged at ~3220 g for 5 min (Eppendorf #A-4-81 rotor) to pellet down precipitated dyes ...