Labshake search
Citations for Eppendorf :
1 - 50 of 123 citations for 7 Bromo 1H indazole 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Reactions were incubated for 1h at 22°C in a thermomixer (Eppendorf) with mixing set to 1000 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reactions were performed on ice for 1h in LoBind tubes (Eppendorf) to minimize protein loss ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... followed by another round of centrifugation at 21,000xg 4°C for 1h (Eppendorf, Centrifuge 5424R). Pellets were stored at −70°C ...
-
bioRxiv - Systems Biology 2021Quote: ... Cells were seeded on poly-L-lysine pretreated (0.001%, 1h) 24-well imaging plates (Eppendorf, Germany) at a density of 1e05 cells/well ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mixtures were then incubated at 37°C and 1500 rpm for 1h in a ThermoMixer (Eppendorf) before being subjected to centrifugation for 30 minutes at 15,000 rpm ...
-
bioRxiv - Plant Biology 2023Quote: ... and then were incubated for 1h at 28°C with shaking at 300 rpm (Eppendorf, ThermoMixer C). Samples were diluted 10-fold ...
-
bioRxiv - Synthetic Biology 2019Quote: ... in a rotating wheel (TC-7, New Brunswick/Eppendorf, Belgium). The next day ...
-
bioRxiv - Neuroscience 2022Quote: ... Blood samples were collected on ice and centrifuged within 1h at 4°C for 10min at 3000 RPM (Eppendorf, Centrifuge 5804R). Separated plasma was stored at -80°C until the protein assay was initiated.
-
bioRxiv - Immunology 2023Quote: ... Samples were then washed twice with s-trap loading buffer before addition of 2µg of Trypsin and incubated for 1h on a shaking 47°C incubator (Eppendorf, ThermoMix C). Samples were then removed from the column in a three-step elution with 40µL of TEAB (pH 8 ...
-
bioRxiv - Immunology 2022Quote: ... Samples were then incubated for 1h while shaking at 750 rpm at room temperature in and Eppendorf thermal shaker (Eppendorf, The Netherlands). Following the incubation ...
-
bioRxiv - Microbiology 2021Quote: ... centrifuged at 7000 RPM for 7 min at 4 °C (Eppendorf model 5804R). The supernatant was discarded ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... with ø 7 µm collection capillary and separated by piezo-vibrator PiezoXpert (Eppendorf, Germany). Single-cell state hemocytes were individually transferred to 2.3 µl of lysis buffer (38 ...
-
bioRxiv - Cell Biology 2024Quote: ... and denatured at 85°C for 7 minutes using a ThermoMixer® C-PCR 384 (Eppendorf). After denaturation ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Molecular Biology 2021Quote: ... complete amino acid supplementation) overnight in 96-well flat bottom plates (Eppendorf), diluted into fresh medium with a dilution factor of 200 ...
-
bioRxiv - Neuroscience 2021Quote: ... starting from 100 ng of total RNA (RIN ≥7) on an epMotion® 5075 TMX workstation (Eppendorf). Library QC included size distribution check (BioAnalyser ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA samples were collected in 2.0 ml nucleic acid LoBind tubes (Eppendorf) and stored at −80 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... was injected at a concentration of 40 mM in embryos either at the end of cellularization around 5 min before imaging or at stage 7 during imaging using an InjectMan4 micromanipulator and a FemtoJet 4i microinjector from Eppendorf directly installed on the imaging microscope.
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2022Quote: ... Eluted lysates in 60% acetonitrile/0.1% formic acid were dried by vacuum centrifugation (Eppendorf; Concentrator Plus) at 45°C.
-
bioRxiv - Biochemistry 2023Quote: ... in 0.3% acetic acid was added to a 96-well plate (CAT# 0030128664, Eppendorf, Hamburg, Germany), sealed with plate seal (CAT# 5010-21951 ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were kept soaked at 37 °C for up to 7 days on an orbital shaker (Excella E24, Eppendorf, Hamburg, Germany) with an agitation rate of 150 rpm ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfected cells were transferred into 8.0 mL of MA2 media in 20 mL culture tubes and allowed to recover while rotating (∼80 rpm) in the outer rim of a tissue culture roller drum (New Brunswick; model TC-7; Eppendorf, USA) housed in an Algatron® incubator (Photon Systems Instruments ...
-
bioRxiv - Biophysics 2023Quote: ... The blood was centrifuged at 250 RCF (relative centrifugal force) and 7 rad/s2 acceleration for 20 min (5810 R, Eppendorf, Hamburg, Germany). The platelet rich plasma (PRP ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Microbiology 2019Quote: ... Loaded microfluidic chambers were centrifuged 3 min at 1000 rcf (Eppendorf centrifuge 5430R) to maximize cell adhesion.
-
bioRxiv - Bioengineering 2022Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 tabletop centrifuge) and resuspended ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
bioRxiv - Cell Biology 2019Quote: ... Digested peptides were extracted from gels using 50% ACN solution with 2.5% formic acid (FA) and concentrated in speedVac concentrator (Eppendorf). The aliquot (1/10 ...
-
bioRxiv - Cell Biology 2019Quote: ... Digested peptides were extracted from gels using 50% ACN solution with 2.5% formic acid (FA) and concentrated in speedVac concentrator (Eppendorf). The aliquot (1/10 ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were eluted with 60 μL of buffer B (80% ACN, 0.1% formic acid in H20) and reduced in a Vacufuge plus (Eppendorf) to a final volume of 3 μL ...
-
bioRxiv - Cell Biology 2023Quote: Peptides were eluted from home-made StageTips using 60% acetonitrile and 0.1% formic acid and evaporated to complete dryness using a SpeedVac (Eppendorf). Peptides were reconstituted in 2% formic acid and 2% acetonitrile ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1% trifluoroacetic acid (TFA) (v/v) and the extracts were reduced to dryness using a centrifugal vacuum concentrator (Eppendorf) and re-suspended in 3 % (v/v ...
-
bioRxiv - Genomics 2023Quote: ... eluted with 2 x 100 μl of 70 % (v/v) acetonitrile in 0.5 % (v/v) trifluoroacetic acid into low-binding microcentrifugation tubes (Protein LoBind, Eppendorf), and vacuum-dried in Vacufuge Concentrator Plus (Eppendorf) ...
-
bioRxiv - Microbiology 2024Quote: ... coli cultures and mixed with resuspended in a 1X lysis buffer / Hot Acid Phenol solution in a 1.5 mL microcentrifuge tube on a thermomixer (Eppendorf) set to 65°C ...
-
High resolution, serial imaging of early mouse and human liver bud morphogenesis in three dimensionsbioRxiv - Developmental Biology 2021Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 table top centrifuge) and resuspended ...
-
bioRxiv - Genomics 2020Quote: ... 3 ml of each bacterial suspension were centrifuged at 6,000 × g (Eppendorf, Westbury, NY) for 2 mins ...
-
bioRxiv - Plant Biology 2020Quote: ... The homogenates were centrifuged at 1,000 g for 3 min (Eppendorf 5430, Hamburg, Germany). The subsequent steps of the RNA extraction were performed on the supernatants according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2019Quote: ... The peptide rOv-GRN-1was concentrated using Centripep with cut-off 3 kDa (Eppendorf) and resuspended in low salt solution ...
-
bioRxiv - Systems Biology 2019Quote: ... and 74.9 °C for 3 minutes in a thermocycler (Mastercycler Pro, Eppendorf, Hamberg, Germany) system as described elsewhere (Jafari et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... for 3 min and then reduced to dryness in a Vacufuge centrifugal concentrator (Eppendorf).
-
bioRxiv - Biochemistry 2021Quote: ... The reactions were stopped by the addition of phosphoric acid and 4 µl of each reaction were spotted on P81 phosphocellulose papers (Whatman) using the epMotion 5070 (Eppendorf) workstation ...
-
bioRxiv - Plant Biology 2023Quote: ... The beads were then washed with 3 x 100µL of the lactic acid binding solution and finally resuspended in 50µL and placed into 200 µL tips (Eppendorf, Hauppauge, NY) plugged with 2 layers of 3M™ C8 Empore™ membrane (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... and centrifuged for 3 min at 13806 rpm (Centrifuge 5424, FA-45-24-11, Eppendorf) before use ...