Labshake search
Citations for Eppendorf :
1 - 50 of 1303 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were recovered in 1 mL YPD (1% yeast extract, 2% Bacto peptone, 2% D-glucose) at 30°C in a ThermoMixer C (Eppendorf, Hamburg, Germany) for 3 hours (200 RPM ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and sonicated in chilled PBS (1 s on ...
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Neuroscience 2024Quote: ... regionalized neural organoids (1-3 organoids per one Eppendorf tube) were transferred into a 1.5 mL Eppendorf tube containing 200 μL of the neural medium ...
-
bioRxiv - Genomics 2022Quote: ... Beads and proteins were incubated for 3 hours at 4°C (Eppendorf ThermoMixer, 1,300 rpm). Beads were then washed four times with lysis buffer and recovered in 40 µl of laemmli buffer (50 mM Tris-Cl pH 6.8 ...
-
bioRxiv - Immunology 2023Quote: ... Remaining bacteria were pelleted for 2 min at 16100× g (Eppendorf Centrifuge 5415 D) and supernatants containing the oligopeptide phage libraries were collected and stored at 4 °C.
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... followed by another round of centrifugation at 21,000xg 4°C for 1h (Eppendorf, Centrifuge 5424R). Pellets were stored at −70°C ...
-
bioRxiv - Biochemistry 2021Quote: ... cell cultures were collected by centrifugation at 3,300 rpm for 3 min at 4°C (using Eppendorf centrifuge 5810R equipped with the A-4-62 rotor ...
-
bioRxiv - Cell Biology 2023Quote: ... the expelled homogenate was palleted by centrifugation for 3 min (at 300 g at 4°C) (Eppendorf). The pellet was discarded ...
-
bioRxiv - Neuroscience 2023Quote: ... PFF oligomers were incubated with or without SVD-1a in PBS pH 7.4 for 3 d at 37 °C under quiescent condition in low retention Eppendorf tubes (Eppendorf, GE). Prior to injection ...
-
bioRxiv - Molecular Biology 2023Quote: ... Yeast were centrifuged at 3,000 rpm for 3 min in an A-4-62 swing bucket rotor (Eppendorf) and resuspended in 20 ml 1 M sorbitol and incubated at 4 °C overnight (<18 h) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Samples were then extracted for 3 hr at 4°C in a ThermoMixer (Eppendorf US, Enfield, CT, USA), followed by evaporation of the methanol component with a speedvac concentrator (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Microbiology 2022Quote: Cells (2 ml cultures) were spun down (30 s Eppendorf centrifuge, 14,000 rpm, 4 °C), resuspended in 0.4 ml ice-cold growth medium and added to a screw cap Eppendorf tube containing 1.5 g glass beads (0.1 mm) ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...
-
bioRxiv - Synthetic Biology 2022Quote: The concentration and quality of the plasmid solutions were determined by diluting 1 ul of plasmid solution in 4 ul of Tris EDTA buffer and loading 3 ul of the diluted solution on a μCuvette G1 (Eppendorf). Optical densities were measured at 260 nm and 280 nm using a BioSpectrophotometer and Fluorimeter (Eppendorf) ...
-
bioRxiv - Systems Biology 2024Quote: 20 mL of culture from each of 3 experimental replicates (n = 3) was collected in Protein LoBind tubes (Eppendorf, Hamburg, Germany) by centrifugation at 1650 xg for 10 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were vigorously vortex-mixed for 3 min and centrifuged at 14,000 rpm for 10 min at 4 °C (Eppendorf 5804 R). The clear supernatant was then transferred to a separate vial ...
-
bioRxiv - Plant Biology 2022Quote: ... annealing at 51 °C for 30 s and extension 72 °C for 30 s for 25 cycles by final extension 72 °C for 3 min and reaction hold at 4 °C in a thermocycler (Gradient thermocycler® Eppendorf). Amplified gene products were sequenced using the Sanger sequencing method ...
-
bioRxiv - Neuroscience 2024Quote: ... They were then resuspended to a concentration of ∼800-3000 nuclei per uL across 3-4 x twin.tec™ 96 Well LoBind PCR Plates (Eppendorf, 0030129512) in NSB ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 million cells were added to a 5 mL DNA LoBind tube (Eppendorf, cat. no. 0030108310), centrifuged at 400 x g for 4 min ...
-
bioRxiv - Systems Biology 2023Quote: ... The samples were then distributed evenly over 2 x 5 mL reaction tubes (Eppendorf, Hamburg, Germany) and spun at 14,200 g for 15 min ...
-
Malaria parasite HOPS/CORVET complexes are critical for endocytosis and invasion organelles functionbioRxiv - Cell Biology 2024Quote: ... 200 mM hypoxanthine and 2-5% fresh human RBCs (B+; provided by Universität Klinikum Eppendorf, Hamburg). Cultures were maintained at 37 °C ...
-
bioRxiv - Biophysics 2024Quote: ... The requisite number of cells (2− 5 × 105) was pelleted by centrifugation (#5810, Eppendorf, Hamburg, Germany) at 200g for 3 minutes and the supernatant was discarded ...
-
bioRxiv - Microbiology 2021Quote: ... centrifuged at 7000 RPM for 7 min at 4 °C (Eppendorf model 5804R). The supernatant was discarded ...
-
bioRxiv - Microbiology 2024Quote: ... spore suspensions (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) were directly exposed to either of the two temperatures for two weeks ...
-
bioRxiv - Systems Biology 2021Quote: ... Total volume of 20 mL from each culture was transferred to a 50 mL Falcon® filled with ice and was immediately centrifuged at 3000 rpm for 3 min at 4 °C (Eppendorf centrifuge). Next the supernatant was discarded and the cell pellet was snap frozen into liquid nitrogen and stored at -80 °C ...
-
bioRxiv - Systems Biology 2021Quote: For the extraction of total proteome 10 mL of each culture were transferred into ice-cold 15 mL Falcon® tubes which were centrifuged immediately at 3000 rpm for 3 min at 4 °C (Eppendorf centrifuge). The supernatant from the centrifugation was discarded and the cell pellets were washed once with 1 mL of cold PBS buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... The primers were annealed at 95°C for 4 min followed by 70°C for 3 min in a thermocycler (Eppendorf, Hamburg, Germany). The reaction was allowed to cool slowly to room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... the gRNA:Cas9 ribonucleoprotein complex solution was incubated at 37°C for 5 min and then backfilled into 3 microinjection needles using an Eppendorf GELoader tip (Eppendorf, Cat# 022351656). After loading embryos into the embryo holder which covered with 12.5 ppt of salinity water with 0.0001% of methylene blue ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and InjectMan NI 2 (Eppendorf). Cas9 protein (500 ng/μL) ...
-
bioRxiv - Biophysics 2024Quote: ... a 2 mL tube (Eppendorf), containing 1 mL of a 2% BSA + 0.2% FBS in PBS solution ...
-
bioRxiv - Biophysics 2024Quote: ... A 2 mL tube (Eppendorf), containing a suspended cells at a 5 million per mL concentration in a 2% BSA + 0.2% FBS in PBS solution ...
-
bioRxiv - Neuroscience 2022Quote: ... Blood samples were collected on ice and centrifuged within 1h at 4°C for 10min at 3000 RPM (Eppendorf, Centrifuge 5804R). Separated plasma was stored at -80°C until the protein assay was initiated.
-
bioRxiv - Paleontology 2020Quote: ... 5 mg of bone powder was transferred to a 2 mL Eppendorf® tube (Eppendorf; Westbury, NY, USA) and 1 mL of demineralizing solution (5% trifluoroacetic acid (TFA ...
-
bioRxiv - Systems Biology 2024Quote: ... Leaf rosettes were pooled from 5 plants per biological replicate in 2 ml microcentrifuge tubes (Safelock®, Eppendorf) containing two ...