Labshake search
Citations for Eppendorf :
1 - 50 of 951 citations for 7 3 2 3 5 dihydroxyphenyl 2 hydroxyethyl amino propyl 3 7 dihydro 1 3 dimethyl 1H purine 2 6 dione monohydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Biochemistry 2019Quote: ... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and sonicated in chilled PBS (1 s on ...
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Microbiology 2019Quote: ... Loaded microfluidic chambers were centrifuged 3 min at 1000 rcf (Eppendorf centrifuge 5430R) to maximize cell adhesion.
-
bioRxiv - Bioengineering 2022Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 tabletop centrifuge) and resuspended ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
High resolution, serial imaging of early mouse and human liver bud morphogenesis in three dimensionsbioRxiv - Developmental Biology 2021Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 table top centrifuge) and resuspended ...
-
bioRxiv - Genomics 2020Quote: ... 3 ml of each bacterial suspension were centrifuged at 6,000 × g (Eppendorf, Westbury, NY) for 2 mins ...
-
bioRxiv - Plant Biology 2020Quote: ... The homogenates were centrifuged at 1,000 g for 3 min (Eppendorf 5430, Hamburg, Germany). The subsequent steps of the RNA extraction were performed on the supernatants according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2019Quote: ... The peptide rOv-GRN-1was concentrated using Centripep with cut-off 3 kDa (Eppendorf) and resuspended in low salt solution ...
-
bioRxiv - Systems Biology 2019Quote: ... and 74.9 °C for 3 minutes in a thermocycler (Mastercycler Pro, Eppendorf, Hamberg, Germany) system as described elsewhere (Jafari et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... for 3 min and then reduced to dryness in a Vacufuge centrifugal concentrator (Eppendorf).
-
bioRxiv - Developmental Biology 2023Quote: ... the gRNA:Cas9 ribonucleoprotein complex solution was incubated at 37°C for 5 min and then backfilled into 3 microinjection needles using an Eppendorf GELoader tip (Eppendorf, Cat# 022351656). After loading embryos into the embryo holder which covered with 12.5 ppt of salinity water with 0.0001% of methylene blue ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mixture was sonicated 3 times for 1 minute in a waterbath sonicator and incubated in a ThermoMixer (Eppendorf) for 30 minutes at 37°C and 500 rpm ...
-
bioRxiv - Microbiology 2021Quote: ... and centrifuged for 3 min at 13806 rpm (Centrifuge 5424, FA-45-24-11, Eppendorf) before use ...
-
bioRxiv - Microbiology 2019Quote: ... all culture samples were centrifuged for 3 min at 15871 rcf (Centrifuge 5424, Eppendorf, Germany) in 1.5-mL reaction tubes ...
-
bioRxiv - Bioengineering 2022Quote: ... the purification was carried out in 3 steps using a standard centrifuge (Eppendorf centrifuge 5425). We washed the sample using ethanol and 2 washing buffers provided by the kit ...
-
bioRxiv - Neuroscience 2022Quote: ... was added per well using electronic 12-channel pipettes in speed 3 (e12c-pip; Eppendorf). The plates were temporality incubated at 37°C ...
-
bioRxiv - Systems Biology 2022Quote: ... 3) collected filtrate was evaporated dry over-night in a concentrator (Eppendorf® concentrator plus) under vacuum conditions ...
-
bioRxiv - Systems Biology 2022Quote: ... After denaturation at 78 °C for 3 min on a flatblock thermocycler (Eppendorf, Mastercycler Nexus), samples were incubated at 45 °C for 36–48 hr in a benchtop incubator ...
-
bioRxiv - Genomics 2022Quote: ... Beads and proteins were incubated for 3 hours at 4°C (Eppendorf ThermoMixer, 1,300 rpm). Beads were then washed four times with lysis buffer and recovered in 40 µl of laemmli buffer (50 mM Tris-Cl pH 6.8 ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Biophysics 2022Quote: ... the DNA droplet-containing aqueous phase was layered on top of the oil phase in a volumetric ratio of 1:3 within a microtube (Eppendorf). For the segregation of DNA droplets using enzymatic activity ...
-
bioRxiv - Biophysics 2022Quote: ... The aqueous solution was layered on top of the oil-surfactant mix in a volumetric ratio of 1:3 inside a microtube (Eppendorf). The tube was manually shaken for about 30 s until water-in-oil droplets formed ...
-
bioRxiv - Biophysics 2020Quote: ... the DNA-containing aqueous phase was layered on top of the oil phase in a volumetric ratio of 1:3 within a microtube (Eppendorf). Droplet formation was induced by manual shaking for about 4 s as described earlier.[26] For the oil-phase ...
-
bioRxiv - Genomics 2024Quote: ... and washed in nuclease-free H2O before proceeding to MNase digestion with 1-2U of MNase for 3×106 cells that went on for 1-hour at 37C while shaking in a thermomixer (Eppendorf) at 550rcf ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 ml was aliquoted to each of the duplicate 5.0 mL tubes (Eppendorf Tubes®, Germany) while 50 μL was aliquoted to each of the duplicate 200 μL Polymerase Chain Reaction (PCR ...
-
bioRxiv - Plant Biology 2022Quote: ... Fermentation was conducted in approximately 3 L of culture in a bioreactor BioFlo120 (Eppendorf, Hamburg, Germany) at 30°C for 5 days ...
-
bioRxiv - Genetics 2022Quote: ... and spun at 100x g for 3 min in a swing-bucket centrifuge (e.g., Eppendorf 5804R). The cycling conditions are 95°C for 3 min ...
-
bioRxiv - Microbiology 2023Quote: ... the fermentation broth was centrifuged at 9000 r/min for 3 min (Eppendorf Centrifuge 5424, Germany), and the resultant pellet was collected for bacterial DNA extraction using the FastDNA® Spin Kit for Soil (MP Biomedicals ...
-
bioRxiv - Bioengineering 2023Quote: ... MPCs were washed twice for 3 min at 400 RCF at room temperature with PBS supplemented with 1% glucose and 1% pen-strep (Eppendorf 5702R, Hamburg, Germany). Biotinylation of the cell surface was performed by adding 1 mM Sulfo-NHS-LC-Biotin (Thermo Fisher ...
-
bioRxiv - Biochemistry 2021Quote: ... cell cultures were collected by centrifugation at 3,300 rpm for 3 min at 4°C (using Eppendorf centrifuge 5810R equipped with the A-4-62 rotor ...