Labshake search
Citations for Eppendorf :
151 - 200 of 994 citations for 7' BROMO 2' 3' DIHYDRO 1'H SPIRO CYCLOPENTANE 1 4' ISOQUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 1 min), annealing (65°C, 1 min), and elongation (72°C, 1 min) were performed in a Mastercycler thermal cycler (Eppendorf, Germany). A final extension step was added for 10 min at 72 °C at the end of the 30th amplification cycle ...
-
bioRxiv - Neuroscience 2024Quote: ... The forebrain was dissected and weighed before lyophilization at a shelf temperature of –56 °C for 24h under vacuum of 0.2 mBar (Christ LMC-1 BETA 1-16) and extraction with formamide at 57°C for 24h on a shaker at 300 rpm (Eppendorf Thermomixer). Integrated density of tracer fluorescence was determined in triplicates after 1:3 ethanol dilutions ...
-
bioRxiv - Neuroscience 2021Quote: ... starting from 100 ng of total RNA (RIN ≥7) on an epMotion® 5075 TMX workstation (Eppendorf). Library QC included size distribution check (BioAnalyser ...
-
bioRxiv - Cell Biology 2022Quote: ... for 16 h at 37 °C using Thermomixer C (Eppendorf AG, Hamburg, Germany). The peptide was extracted thrice from gel with a mixture of 60/40/0.1 (v/v/v) ...
-
bioRxiv - Neuroscience 2020Quote: ... and rotor (Eppendorf #S-4-72). Upon end of centrifugation ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 C (Eppendorf Centrifuge 5418 R). Proteins in the clear supernatant (protein extract ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 C (Eppendorf Centrifuge 5418 R). 15 µg of recombinant FAMOSS-streptavidin/streptavidin was added to supernatant and incubated 1h on ice with rotation ...
-
bioRxiv - Biophysics 2023Quote: ... with a micromanipulator InjectMan 4 (Eppendorf). The injection needles Femtotip II (Eppendorf ...
-
bioRxiv - Synthetic Biology 2024Quote: ... in a MasterCycler RealPlex 4 (Eppendorf). Each 20 μL qPCR reaction contained 90 ng of cDNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... A Femtotip microcapillary (1 μm tip diameter, Eppendorf, Germany) was mounted onto a Femtojet pump and micromanipulator (Eppendorf) ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, Eppendorf #A-4-81 rotor) to remove intact cells and debris ...
-
bioRxiv - Genomics 2023Quote: ... and centrifuged at 3,200 g and 4°C using a swinging-bucket rotor (Eppendorf A-4-81) for 5 mins ...
-
bioRxiv - Microbiology 2023Quote: ... After 48 h the cultures were centrifuged at 3,800 rpm (Eppendorf Centrifuge 5810 R) for 30 min at room temperature ...
-
bioRxiv - Biophysics 2023Quote: ... at 37 C between 16 – 24 h at 800 rpm (ThermoMixer C, Eppendorf, Germany). 10 µL of saturated culture was then reset in 1 mL of LB before incubating an additional 2 h ...
-
bioRxiv - Cell Biology 2019Quote: ... The lysate was centrifuged at 4°C at 3220 g for 15 min (Eppendorf #A-4-81 rotor) to remove intact cells and debris ...
-
bioRxiv - Immunology 2020Quote: ... (Eppendorf Centrifuge 5810R, rotor A-4-62) at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... in a Realplex 4 PCR machine (Eppendorf), and values were normalized to rpl-32 as an internal control ...
-
bioRxiv - Biophysics 2022Quote: ... and a micro-manipulator (Injectman 4; Eppendorf). Injection pipettes were prepared from siliconized (Sigmacote ...
-
bioRxiv - Cell Biology 2023Quote: ... in a realplex 4 qPCR cycler (Eppendorf). To calculate the relative mtDNA levels ...
-
bioRxiv - Cell Biology 2022Quote: ... and agitated (1,300rpm, 30 min, 1°C; Thermomixer Comfort, Eppendorf). Solubilized membrane proteins were obtained in the supernatant from this agitated suspension by centrifugation (21,000g ...
-
bioRxiv - Immunology 2020Quote: ... The pH of the eluate (1 mL per Eppendorf tube) was neutralized (125 µL of Tris 1M ...
-
bioRxiv - Immunology 2019Quote: ... for 1 hour at 37°C in a Thermomixer (Eppendorf) with shaking set at 1000rpm ...
-
bioRxiv - Microbiology 2020Quote: ... The remaining 1 mL of culture was centrifuged (Eppendorf 5417R) at 8000xg and washed twice with 1 mL of LB media ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1 ml aliquots were concentrated in a speed-vac (Eppendorf) for 45 min at 30°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) to remove intact cells and debris ...
-
bioRxiv - Developmental Biology 2019Quote: ... was injected at a concentration of 40 mM in embryos either at the end of cellularization around 5 min before imaging or at stage 7 during imaging using an InjectMan4 micromanipulator and a FemtoJet 4i microinjector from Eppendorf directly installed on the imaging microscope.
-
bioRxiv - Biochemistry 2020Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, Eppendorf #A-4-81 rotor) and washed with ice-cold 50 mL Binding buffer composed of 10 mM imidazole (pH 7.4) ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were immediately cooled on ice and centrifuged for 12 min at 4°C and 3700 rpm (Centrifuge 5920 R, S-4×1000, Eppendorf). The cell pellets were stored at −20°C until RNA extraction.
-
bioRxiv - Microbiology 2021Quote: ... The cells were transferred into anaerobic 50 mL reaction tubes inside the anaerobic chamber and harvested outside of the anaerobic chamber for 12 min at 4°C and 3700 rpm (Centrifuge 5920 R, S-4×1000, Eppendorf). The supernatant was discarded inside the anaerobic chamber and the pellet was resuspended in fresh RCM medium to an OD600 of 5-10 ...
-
bioRxiv - Genomics 2019Quote: ... incubated for 5 min at 4 °C with rotation and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and InjectMan NI 2 (Eppendorf). Cas9 protein (500 ng/μL) ...
-
bioRxiv - Physiology 2020Quote: ... 1% Antibiotic-Antimycotic] in a 5% CO2 incubator (Galaxy 170R, Eppendorf) at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... bacterial cultures (1 mL) were separately transferred to sterile cuvettes (Eppendorf), and the optical density (OD600 ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by centrifugation (1000 rpm, 1 minute, Eppendorf 5804R, Hamburg, Germany) and subsequently the plates were incubated for 30 minutes at room temperature (RT) ...
-
bioRxiv - Molecular Biology 2022Quote: ... at 211 g for 1 hour at room temperature (Eppendorf ThermoMixerC). Eluate was then removed ...
-
bioRxiv - Molecular Biology 2021Quote: ... and spun down at 2,000 rcf for 1 minute (Eppendorf 5810R) before stored at −80 °C.
-
bioRxiv - Synthetic Biology 2020Quote: Batch fermentations were conducted in 1 L DASGIP bioreactors (Eppendorf, Germany) with an initial volume of 550 mL ...
-
bioRxiv - Cell Biology 2022Quote: ... Aliquoted extracts were dried in vacuo (Eppendorf concentrator 5301, 1 ppm) and redissolved in 2-propanol (15 ul ...
-
bioRxiv - Biochemistry 2023Quote: ... Aliquoted extracts were dried in vacuo (Eppendorf concentrator 5301, 1 ppm) and redissolved in 2propanol (15μl ...
-
bioRxiv - Molecular Biology 2024Quote: ... then transferred to a 1-mL DNA LoBind tube (Eppendorf, 022431021). Cells were resuspended to 1 mL PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... and InjectMan®4 micromanipulator (Cat#. 5192000035, Eppendorf) using external continuous pressure ...
-
bioRxiv - Immunology 2021Quote: ... at 10.000 rpm and 4°C (Eppendorf 5804R), for the removal of residual titanium [16].
-
bioRxiv - Cell Biology 2022Quote: ... for 10 minutes at 4°C (Eppendorf, Germany), and supernatants were transferred into fresh tubes to be evaporated to dryness in a CentreVap concentrator at 40°C (Labconco ...
-
bioRxiv - Bioengineering 2024Quote: ... 15 min at 4°C (Eppendorf, Hamburg, Germany). duRNA was generated through equimolar annealing of trRNA/crRNA in duplex buffer (IDT) ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2021Quote: ... and then the total elution fractions were dried for 5 h using a Speed-vac (Eppendorf). The samples were stored at –20°C before use in LC-MS/MS analyses.
-
bioRxiv - Plant Biology 2023Quote: ... It was incubated at 60°C for 0.5 h in a Thermomixer C (Eppendorf, Chennai, India). The samples were RNase-treated ...
-
bioRxiv - Cell Biology 2019Quote: ... The resin was pelleted down by centrifugation at 4°C at 1258 g for 5 min (Eppendorf #A-4-81 rotor) and washed with 25 ml ice-cold binding buffer [10 mM imidazole ...
-
bioRxiv - Biophysics 2020Quote: ... The cell suspension was subsequently centrifuged for 30 min at 4°C and 3250 × g (Eppendorf Swing-bucket rotor A-4-62). The supernatant was discarded ...
-
bioRxiv - Biochemistry 2022Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) and washed with ice-cold 50 mL Binding buffer composed of 10mM imidazole (pH 7.4) ...