Labshake search
Citations for Eppendorf :
1 - 50 of 894 citations for 6H Furo 2 3 g 3 benzazepine 2 ethyl 7 8 9 10 tetrahydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 15.76 g EDTA (pH 8)) in 2 mL Safe-Lock tubes (Eppendorf, Hamburg, Germany). The QIAamp DNA Mini Kit (QIAGEN ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Microbiology 2020Quote: ... 10 g NaCl) in 2 L baffled shake flasks or a 10 L BioFlo 320 Fermenter (Eppendorf) were used to express the I53-50A or I53-50B.4PT1 proteins grown ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Immunology 2022Quote: ... 10 g NaCl) grown in 2 L baffled shake flasks or a 10 L BioFlo 320 Fermenter (Eppendorf). Cells were grown at 37°C to an OD600 ∼ 0.8 ...
-
bioRxiv - Immunology 2020Quote: ... 10 g NaCl) grown in 2 L baffled shake flasks or a 10 L BioFlo 320 Fermenter (Eppendorf). Cells were grown at 37°C to an OD600 ~0.8 ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Genomics 2020Quote: ... 3 ml of each bacterial suspension were centrifuged at 6,000 × g (Eppendorf, Westbury, NY) for 2 mins ...
-
bioRxiv - Plant Biology 2020Quote: ... The homogenates were centrifuged at 1,000 g for 3 min (Eppendorf 5430, Hamburg, Germany). The subsequent steps of the RNA extraction were performed on the supernatants according to the manufacturer’s specifications ...
-
bioRxiv - Cell Biology 2020Quote: ... The homogenate was further incubated on ice for 45 min before centrifugation at 21,000 g and 4°C for 2 x 10 min in an Eppendorf 5424 R benchtop centrifuge (Eppendorf). Protein content of the lysate was determined by BCA assay (Thermo Fisher) ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and sonicated in chilled PBS (1 s on ...
-
bioRxiv - Biochemistry 2019Quote: ... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Biochemistry 2021Quote: ... centrifuged at 12000 rpm (13523 ×g) for 2 min (Eppendorf, 5424 R),transferred to filter-containing centrifuge tubes (Ultrafree-MC-VV ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Genetics 2022Quote: ... and spun at 100x g for 3 min in a swing-bucket centrifuge (e.g., Eppendorf 5804R). The cycling conditions are 95°C for 3 min ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Microbiology 2019Quote: ... 2 000 × g in an Eppendorf 5920R centrifuge (Vaudaux-Eppendorf AG, Schönenbuch, Switzerland). 50 μℓ of supernatant was transferred to a 96-well multi-well plate (Greiner Bio One ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were spun at 2 000 g using 5424R centrifuge (Eppendorf, Hamburg, Germany) for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... 17,000 x g for 2 min using an Eppendorf 5417R centrifuge (Eppendorf, France). Once the supernatant was removed samples were stored at −80 °C until further analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... the expelled homogenate was palleted by centrifugation for 3 min (at 300 g at 4°C) (Eppendorf). The pellet was discarded ...
-
bioRxiv - Bioengineering 2023Quote: ... in LB (10 g Tryptone, 5 g Yeast Extract, 10 g NaCl) grown in a 10 L BioFlo 320 Fermenter (Eppendorf). At inoculation ...
-
bioRxiv - Immunology 2023Quote: ... Remaining bacteria were pelleted for 2 min at 16100× g (Eppendorf Centrifuge 5415 D) and supernatants containing the oligopeptide phage libraries were collected and stored at 4 °C.
-
bioRxiv - Systems Biology 2023Quote: ... samples were pelleted at 6,010 x g for 3 minutes using a bench top centrifuge (Eppendorf 5424/5424R). 100% DMSO was added to resuspend the cell pellet with gentle pipetting until the pellet was completely broken down ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
The conserved membrane-proximal domain of Sbh1/ Sec61β guides signal peptides into the Sec61 channelbioRxiv - Biochemistry 2024Quote: ... Cells (2 OD600) were harvested at 600 x g for 1 min (MiniSpin Centrifuge, Eppendorf) and the supernatants were discarded ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Microbiology 2023Quote: ... The beads were pelleted (600 x g, 3 min) and the supernatant transferred to a fresh low protein binding tube (Eppendorf). The beads were washed with 1 x 200 µL HPLC-grade water and the washes combined with the original supernatant ...
-
bioRxiv - Bioengineering 2020Quote: The concentration of nitrogen in the media was monitored by taking 1 ml samples from the cultures at various time points and centrifuging them for 3 min at 16900 × g (benchtop 5430R centrifuge; Eppendorf, Germany). The supernatant was retained and the nitrogen concentration was determined using the method of Scheiner71 ...
-
bioRxiv - Neuroscience 2023Quote: ... and tubes centrifuged at 4 °C for 2 min at 12000 x g in a refrigerated microfuge (Eppendorf 5415R). The upper phase was discarded ...
-
bioRxiv - Microbiology 2024Quote: ... Each 9 mL suspension was centrifuged at 9,000 × g for 5 min (Centrifuge 5810 R, Eppendorf, Hamburg, Germany). DNA extraction was performed from the pellet using the GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: The 2 types of ascospores were cleaned by 2 washes with 10% and 20% sucrose solutions and 10-min centrifugation at 1,000 rpm (desktop centrifuge, Eppendorf, Germany); the supernatant was discarded after each centrifugation ...
-
bioRxiv - Molecular Biology 2023Quote: The fully and semi-ejected ascospores were cleaned separately by 2 washes with 10% and 20% sucrose solutions and 10-min centrifugation at 1,000 rpm (desktop centrifuge, Eppendorf, Germany); the supernatant was discarded after each centrifugation ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... pH 8.5 with 1 µg endoproteinase Lys-C (Wako) for 2 hours with shaking at 600 rpm at 37 °C in a thermomixer (Eppendorf). One µg of trypsin (Pierce ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were spun at 10,000 g for 15 min (spin 2 in the same Eppendorf FA-45-48-11 rotor) and the resulting supernatant is the tissue lysate (TL ...
-
bioRxiv - Molecular Biology 2021Quote: ... The beads were pelleted (600 x g, 2 min) and the supernatant was transferred to a fresh low protein binding tube (Eppendorf). The beads were washed with 2 × 300 μL HPLC grade water and the washes combined with the original supernatant ...
-
bioRxiv - Cell Biology 2021Quote: ... spun at 1,000 x g at −9°C for 5 minutes then aliquoted into lo-bind 2ml centrifuge tubes (Eppendorf) and snap frozen in liquid nitrogen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and InjectMan NI 2 (Eppendorf). Cas9 protein (500 ng/μL) ...
-
bioRxiv - Physiology 2019Quote: ... The remaining homogenate was heated for 10 min at 70°C and spun for 3 min at top speed at 4°C (Eppendorf 5415R). The supernatant was transferred to a new tube and heated for 10 min at 70°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were vigorously vortex-mixed for 3 min and centrifuged at 14,000 rpm for 10 min at 4 °C (Eppendorf 5804 R). The clear supernatant was then transferred to a separate vial ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2020Quote: ... the medium exchange was conducted under semi-sterile conditions directly at the microscope with a 10 μl microloader tip (Microloader Tip 0,5-10 μl / 2-20 μl, Eppendorf AG, Hamburg, Germany) every two days.
-
bioRxiv - Biochemistry 2022Quote: ... samples were prepared in 96 well microtiter plates by adding 12.5 μL reaction supernatant to 50 μL acetonitrile with 1% v/v trifluoroacetic acid (TFA) followed by centrifugation (2,204 g, 30 min; A-2-DWP rotor, Eppendorf AG, Hamburg, Germany) and transferring of 50 μL centrifugation supernatant into 150 μL MilliQ H2O ...
-
bioRxiv - Microbiology 2023Quote: ... Cultures were centrifuged (10 min; 3,220 g; Eppendorf Centrifuge 5810R), washed in 0.9% NaCl and resuspended to 107 cell/mL in modified 10% BHI ...
-
bioRxiv - Molecular Biology 2019Quote: ... using a Realplex 2 thermocycler (Eppendorf). The PCR conditions were 95°C for 3 min ...
-
bioRxiv - Immunology 2022Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was mounted on an Andor Spinning Disc Microscope and microinjection was performed using the microinjector FemtoJet with a 100X oil immersion objective to facilitate immediate visualization and image acquisition after microinjection ...