Labshake search
Citations for Eppendorf :
1 - 50 of 1091 citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... in LB (10 g Tryptone, 5 g Yeast Extract, 10 g NaCl) grown in a 10 L BioFlo 320 Fermenter (Eppendorf). At inoculation ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15.76 g EDTA (pH 8)) in 2 mL Safe-Lock tubes (Eppendorf, Hamburg, Germany). The QIAamp DNA Mini Kit (QIAGEN ...
-
bioRxiv - Microbiology 2024Quote: ... Each 9 mL suspension was centrifuged at 9,000 × g for 5 min (Centrifuge 5810 R, Eppendorf, Hamburg, Germany). DNA extraction was performed from the pellet using the GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... spun at 1,000 x g at −9°C for 5 minutes then aliquoted into lo-bind 2ml centrifuge tubes (Eppendorf) and snap frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... 10 g NaCl) in 2 L baffled shake flasks or a 10 L BioFlo 320 Fermenter (Eppendorf) were used to express the I53-50A or I53-50B.4PT1 proteins grown ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Immunology 2022Quote: ... 10 g NaCl) grown in 2 L baffled shake flasks or a 10 L BioFlo 320 Fermenter (Eppendorf). Cells were grown at 37°C to an OD600 ∼ 0.8 ...
-
bioRxiv - Immunology 2020Quote: ... 10 g NaCl) grown in 2 L baffled shake flasks or a 10 L BioFlo 320 Fermenter (Eppendorf). Cells were grown at 37°C to an OD600 ~0.8 ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Biochemistry 2022Quote: ... After 5 min incubation at room temperature (RT) the sample was centrifuged (8 min, RT, 180 x g, Eppendorf centrifuge 5810R) to separate proteoliposomes from the non-incorporated protein and detergent ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Cell Biology 2020Quote: ... The homogenate was further incubated on ice for 45 min before centrifugation at 21,000 g and 4°C for 2 x 10 min in an Eppendorf 5424 R benchtop centrifuge (Eppendorf). Protein content of the lysate was determined by BCA assay (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2019Quote: ... for 5 minutes at 3,500 RPM (2,465 x g, Eppendorf 5810R v3.3 centrifuge with A-4-62 rotor ...
-
Sex-specific fear acquisition following early life stress is linked to amygdala glutamate metabolismbioRxiv - Animal Behavior and Cognition 2024Quote: ... the samples were centrifuged at 13 000 rpm for 10 min at 10°C with Centrifuge 5424 R (Eppendorf AG, Hamburg, Germany). The clear supernatant was transferred to a 1.5 mL glass vial with insert ...
-
bioRxiv - Microbiology 2023Quote: ... Cultures were centrifuged (10 min; 3,220 g; Eppendorf Centrifuge 5810R), washed in 0.9% NaCl and resuspended to 107 cell/mL in modified 10% BHI ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were spun down (5 min, 800 g•, 2 °C, minimal acceleration and break, Eppendorf 5810 R with swing-×bucket rotor A-4-44). The medium was discarded and the cells were dissociated in 15 mL of ice cold ACK solution (0.15 M NH4Cl ...
-
bioRxiv - Microbiology 2019Quote: ... The culture was centrifuged at 10,000 g for 5 mins (Eppendorf 5810R) and bacterial pellet was resuspended in DMEM-10 and incubated at 37°C for at least an hour ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Genomics 2020Quote: ... 3 ml of each bacterial suspension were centrifuged at 6,000 × g (Eppendorf, Westbury, NY) for 2 mins ...
-
bioRxiv - Plant Biology 2020Quote: ... The homogenates were centrifuged at 1,000 g for 3 min (Eppendorf 5430, Hamburg, Germany). The subsequent steps of the RNA extraction were performed on the supernatants according to the manufacturer’s specifications ...
-
bioRxiv - Biochemistry 2021Quote: ... centrifuged at 12000 rpm (13523 ×g) for 2 min (Eppendorf, 5424 R),transferred to filter-containing centrifuge tubes (Ultrafree-MC-VV ...
-
bioRxiv - Neuroscience 2019Quote: Centrifuge for 5 min at 900 rpm/154 g in Centrifuge 5810 (Eppendorf).
-
bioRxiv - Neuroscience 2020Quote: ... in PBS) and pelleted again (500 × g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Genomics 2024Quote: ... 1 mL of well-grown culture was centrifuged (5 min, 2040 g; Eppendorf) and the superfluous medium was removed by pipetting ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2019Quote: ... incubated for 5 min at 4 °C with rotation and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Microbiology 2019Quote: ... 2 000 × g in an Eppendorf 5920R centrifuge (Vaudaux-Eppendorf AG, Schönenbuch, Switzerland). 50 μℓ of supernatant was transferred to a 96-well multi-well plate (Greiner Bio One ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were spun at 2 000 g using 5424R centrifuge (Eppendorf, Hamburg, Germany) for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... 17,000 x g for 2 min using an Eppendorf 5417R centrifuge (Eppendorf, France). Once the supernatant was removed samples were stored at −80 °C until further analysis ...
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected after centrifugation at 13 000 rpm for 10 min at room temperature (Centrifuge 5415R; Eppendorf, Hamburg, Germany). Total protein concentration was measured using BCA assay ...
-
bioRxiv - Biochemistry 2019Quote: ... for 25 min at room temperature followed by centrifugation at 13 000 rpm for 10 min at 20 oC (Centrifuge 5415R; Eppendorf, Germany). Then the supernatant was dried in SpeedVac at 45 oC ...
-
bioRxiv - Genomics 2019Quote: ... in PBS) and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 µL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Neuroscience 2024Quote: ... samples were layered on top of the 105 µl cushion and spun at 10,000 g for 20 min at 4°C in a swing out rotor (A-8-11 swing bucket rotor, Eppendorf) to isolate CpxII bound to trans SNARE complexes (SNAREpins ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... and spun at 100x g for 3 min in a swing-bucket centrifuge (e.g., Eppendorf 5804R). The cycling conditions are 95°C for 3 min ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Microbiology 2022Quote: ... 10 mM HEPES and seeded on confluent HFF monolayers in 8-well chamber slides (Eppendorf) at a density of 5×105 tachyzoites/well ...
-
bioRxiv - Immunology 2023Quote: ... Remaining bacteria were pelleted for 2 min at 16100× g (Eppendorf Centrifuge 5415 D) and supernatants containing the oligopeptide phage libraries were collected and stored at 4 °C.
-
bioRxiv - Systems Biology 2019Quote: ... and the bacterial cells were harvested by centrifugation (swing-out rotor A-4-44, Eppendorf; 3220 g, 8 min, 30°C). The cell pellet was resuspended in the mineral medium and centrifuged again ...
-
bioRxiv - Biochemistry 2020Quote: ... The solution was centrifuged at ~3220 g for 5 min (Eppendorf #A-4-81 rotor) to pellet down precipitated dyes ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBS) and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf, RRID:SCR_018092). Nuclei were resuspended in 500 µL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Cell Biology 2021Quote: ... Beads were spun down at 3000 × g for 5 min with minimal deceleration (Eppendorf 5804R) and washed 3 times with RP buffer ...
-
bioRxiv - Microbiology 2019Quote: ... centrifuged at 3000 × g for 5 min at 4°C (Centrifuge 5424, Eppendorf, Hamburg, Germany), and frozen at −20°C for bacterial DNA extraction ...
-
bioRxiv - Cell Biology 2023Quote: ... the expelled homogenate was palleted by centrifugation for 3 min (at 300 g at 4°C) (Eppendorf). The pellet was discarded ...
-
bioRxiv - Immunology 2020Quote: ... The cultures were placed on ice for 10 minutes to slow growth then centrifuged at 3,000 × g for 10 minutes at 4°C (Eppendorf 5810R). The supernatants were discarded and the pellets were resuspended in fresh RPMI 10mM glucose until a McFarland of 5.0 (∼109 CFU/mL ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Cells were pelleted at 4 000 x g for 10 min (Eppendorf 5810R, Germany). Throughout the experiment ...
-
bioRxiv - Microbiology 2020Quote: ... by centrifugation (4500×g, 10 min, 28°C) using a swing-bucket rotor (Eppendorf). Concentrated biomass was washed and resuspended in nitrite free growth medium for the MR experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by centrifugation at 300 × g for 10 min at 4°C (# 5720R Eppendorf). The supernatant was transferred to a new 15-mL polypropylene tube and centrifuged at 2,000 × g for 10 min at 4°C (# 5720R Eppendorf) ...