Labshake search
Citations for Eppendorf :
401 - 450 of 1008 citations for 6 tert Butyl 2 3 dihydro benzo 1 4 dioxine 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2023Quote: ... at 4°C for 1 hour and centrifuged at 4°C at 14200 rpm for 50 min using a refrigerated table-top centrifuge (Eppendorf Centrifuge, Hamburg, Germany). The cleared lysates were loaded on wells of 96-well single-use filter micro-plates with 3 µm glass fibers and 25 µm polyethylene membranes (Agilent ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were then digested for 4 h at 37°C (1000 x rpm for 1 h, then 650 x rpm, Eppendorf ThermoMixer®C). Samples were then diluted 1:1 with milliQ water ...
-
bioRxiv - Cell Biology 2019Quote: ... The resin was pelleted down by centrifugation at 4°C at 1258 g for 5 min (Eppendorf #A-4-81 rotor) and washed with 25 ml ice-cold binding buffer [10 mM imidazole ...
-
bioRxiv - Bioengineering 2019Quote: ... centrifuging for 5 min at 400 rcf (RT, Eppendorf 5430; Rotor: F-35-6-30), re-suspension in fresh medium and transfer to cultivation flask.
-
bioRxiv - Biochemistry 2021Quote: ... cells were seeded into 6-well or 12-well polystyrene coated plates (Eppendorf; EP0030720130, EP0030721012) at a density of 0.3 x 106 cells mL−1 or 0.1 x 106 cells mL−1 ...
-
bioRxiv - Cell Biology 2022Quote: ... Eluted lysates in 60% acetonitrile/0.1% formic acid were dried by vacuum centrifugation (Eppendorf; Concentrator Plus) at 45°C.
-
bioRxiv - Biochemistry 2023Quote: ... in 0.3% acetic acid was added to a 96-well plate (CAT# 0030128664, Eppendorf, Hamburg, Germany), sealed with plate seal (CAT# 5010-21951 ...
-
bioRxiv - Biophysics 2020Quote: ... The cell suspension was subsequently centrifuged for 30 min at 4°C and 3250 × g (Eppendorf Swing-bucket rotor A-4-62). The supernatant was discarded ...
-
bioRxiv - Biochemistry 2022Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) and washed with ice-cold 50 mL Binding buffer composed of 10mM imidazole (pH 7.4) ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 10 sec (5424-R Eppendorf microfuge) and the pellet was resuspended with 400 μl TES Solution (10 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... 20°C for 4 hours (Thermomixer 5355 R, Eppendorf). After incubation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reactions were performed in a Realplex 4 Thermocycler (Eppendorf) using the following program ...
-
bioRxiv - Immunology 2024Quote: ... on a MasterCycler EP Realplex 4 thermal cycler (Eppendorf) in 96-well-plate format ...
-
bioRxiv - Biophysics 2021Quote: ... Lipid extracts were resuspended in 60 μl 10mM ammonium acetate in methanol and diluted 1:4 in 96-well plates (Eppendorf twin.tec® 96; Sigma-Aldrich) prior to measurement of PC species ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and then 6 mL of the culture was collected by centrifugation at 2,500g (5810 R, Eppendorf) for 5 min at room temperature.
-
bioRxiv - Neuroscience 2020Quote: ... for 30 min at 4°C on centrifuge (Eppendorf #5804R) and rotor (Eppendorf #S-4-72) ...
-
bioRxiv - Cell Biology 2022Quote: ... Microneedles were manually controlled with an InjectMan 4 micromanipulator (Eppendorf). The compensation pressure set on the FemtoJet was 35hPa for the whole injection experiment to avoid damages on cells ...
-
bioRxiv - Biophysics 2022Quote: ... The probe was controlled with a micromanipulator (Injectman 4; Eppendorf) and mounted on an inverted epifluorescent microscope.
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was centrifuged (Eppendorf 5810R, A-4-62 Rotor) for 10 minutes at 500 x g to separate the remaining blood cells from the plasma.
-
bioRxiv - Molecular Biology 2024Quote: ... followed by high-speed centrifugation (4°C, 12000rpm, Eppendorf, 5424R) for 20 minutes to collect the protein supernatant ...
-
bioRxiv - Synthetic Biology 2022Quote: ... a 6 mL portion of each cell culture was collected by centrifugation at 2,500g (5810 R, Eppendorf) for 5 min at 4 °C ...
-
bioRxiv - Microbiology 2019Quote: ... four 50 mL aliquots from each trap were centrifuged at 3214 x g and 4°C for 30 minutes (Eppendorf 5810 R, S-4-104 rotor). The supernatant was decanted after centrifugation and cell pellets were stored at −80°C until ready for freeze-drying and lipid extraction ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Microbiology 2019Quote: ... Loaded microfluidic chambers were centrifuged 3 min at 1000 rcf (Eppendorf centrifuge 5430R) to maximize cell adhesion.
-
bioRxiv - Bioengineering 2022Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 tabletop centrifuge) and resuspended ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
bioRxiv - Plant Biology 2021Quote: ... samples were centrifuged (20 min, 15,000g, 4°C, in an Eppendorf 5810R centrifuge ...
-
bioRxiv - Genomics 2021Quote: ... and held at 4 C° using the Mastercycler Nexus (Eppendorf, Australia). This was then cycled a total of 40 times ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and centrifuged at 13 000 rpm/15 minutes/4°C (Eppendorf Centrifuge 5415R ...
-
bioRxiv - Molecular Biology 2023Quote: ... Melting curves were obtained on a qPCR machine (Eppendorf RealPlex 4), ramping up from 25 to 95 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... and 10,000 × g at 4 °C for 30 min (Eppendorf 5910R). Pre-cleared supernatants were subjected to ultracentrifugation at 29,000 rpm using a Beckman SW40 Ti rotor (RCFavg ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting supernatant was centrifuged (Eppendorf 5810R, A-4-62 Rotor) for 10 minutes at 500 x g to separate the cells from plasma ...
-
bioRxiv - Microbiology 2024Quote: ... veronii cultures were centrifuged for 4 min at 12,000 rpm (Eppendorf centrifuge 5810R with an F-34-6-38 rotor ...
-
bioRxiv - Cancer Biology 2024Quote: ... or a realplex 4 qPCR 96-Well Real Time Cycler (Eppendorf) with 5% of the immunoprecipitated DNA used in a 20 ul PCR reaction ...
-
bioRxiv - Cancer Biology 2024Quote: ... in a Realplex 4 qPCR 96-Well Real Time Cycler (Eppendorf). Ct values were internally normalized to GAPDH for each sample ...
-
bioRxiv - Bioengineering 2019Quote: ... The suspension was centrifuged at 500 rcf for 10 min RT (Eppendorf 5430; Rotor: F-35-6-30). These steps were repeated until a white cell pellet was obtained (indicating erythrocyte depletion) ...
-
bioRxiv - Microbiology 2021Quote: ... Three 6-mm leaf discs from three separate leaves were punched directly into an Eppendorf tube (Eppendorf, Germany) containing 500 μl of CSPL buffer (Omega Bio-Tek ...
-
bioRxiv - Biochemistry 2022Quote: ... Wholemeal flour samples were weighed (6 mg) and transferred into a deep well plate (96/1000 μL, Eppendorf). Phosphate buffered saline (600 μL ...
-
bioRxiv - Molecular Biology 2024Quote: A total of 350,000 HEK293-T cells were seeded in each well of 6-well plates (#EP0030720113, Eppendorf). Transfection was performed the day after at 40-50% cell confluence ...
-
bioRxiv - Cell Biology 2019Quote: ... Digested peptides were extracted from gels using 50% ACN solution with 2.5% formic acid (FA) and concentrated in speedVac concentrator (Eppendorf). The aliquot (1/10 ...
-
bioRxiv - Cell Biology 2019Quote: ... Digested peptides were extracted from gels using 50% ACN solution with 2.5% formic acid (FA) and concentrated in speedVac concentrator (Eppendorf). The aliquot (1/10 ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were eluted with 60 μL of buffer B (80% ACN, 0.1% formic acid in H20) and reduced in a Vacufuge plus (Eppendorf) to a final volume of 3 μL ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1% trifluoroacetic acid (TFA) (v/v) and the extracts were reduced to dryness using a centrifugal vacuum concentrator (Eppendorf) and re-suspended in 3 % (v/v ...
-
bioRxiv - Cell Biology 2023Quote: Peptides were eluted from home-made StageTips using 60% acetonitrile and 0.1% formic acid and evaporated to complete dryness using a SpeedVac (Eppendorf). Peptides were reconstituted in 2% formic acid and 2% acetonitrile ...
-
bioRxiv - Genomics 2023Quote: ... eluted with 2 x 100 μl of 70 % (v/v) acetonitrile in 0.5 % (v/v) trifluoroacetic acid into low-binding microcentrifugation tubes (Protein LoBind, Eppendorf), and vacuum-dried in Vacufuge Concentrator Plus (Eppendorf) ...
-
bioRxiv - Microbiology 2024Quote: ... coli cultures and mixed with resuspended in a 1X lysis buffer / Hot Acid Phenol solution in a 1.5 mL microcentrifuge tube on a thermomixer (Eppendorf) set to 65°C ...
-
bioRxiv - Biophysics 2022Quote: ... The lysate was incubated for 30 min on a rotating wheel at 4°C and centrifuged at 16 000 g for 20 min at 4°C (Eppendorf centrifuge 5417-R, Rotor F45-30-11). The supernatant was transferred to a fresh 1.5 ml Eppendorf tube and the pellet was discarded ...
-
High resolution, serial imaging of early mouse and human liver bud morphogenesis in three dimensionsbioRxiv - Developmental Biology 2021Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 table top centrifuge) and resuspended ...
-
bioRxiv - Genomics 2020Quote: ... 3 ml of each bacterial suspension were centrifuged at 6,000 × g (Eppendorf, Westbury, NY) for 2 mins ...