Labshake search
Citations for Eppendorf :
101 - 150 of 1190 citations for 6 methyl 4 oxo N phenyl 2 3 dihydro 1 4 oxathiine 5 carboxamide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 1-5 intact Hydra polyps were incubated per well in a flat bottom 6-well plate (Eppendorf, Hamburg, Germany) filled with 8mL of HM or respective anesthesia ...
-
bioRxiv - Cell Biology 2020Quote: ... and the cells were pelleted by centrifugation at approximately 250 × g for 5 min at 4 °C (Eppendorf 5804 R, Hamburg, Germany). After resuspension ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 10 sec (5424-R Eppendorf microfuge) and the pellet was resuspended with 400 μl TES Solution (10 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... 20°C for 4 hours (Thermomixer 5355 R, Eppendorf). After incubation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reactions were performed in a Realplex 4 Thermocycler (Eppendorf) using the following program ...
-
bioRxiv - Immunology 2024Quote: ... on a MasterCycler EP Realplex 4 thermal cycler (Eppendorf) in 96-well-plate format ...
-
bioRxiv - Biochemistry 2020Quote: ... The rest of the solution was incubated at 4 °C for 1 h on a thermomixer (Eppendorf) set to 1000 rpm ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cell debris was removed via centrifugation at 13,000g for 1 hour at +4°C (Eppendorf 5810r centrifuge). A 1 ml HisTrap FF Crude chromatography column (GE Healthcare ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Neuroscience 2020Quote: ... for 30 min at 4°C on centrifuge (Eppendorf #5804R) and rotor (Eppendorf #S-4-72) ...
-
bioRxiv - Cell Biology 2022Quote: ... Microneedles were manually controlled with an InjectMan 4 micromanipulator (Eppendorf). The compensation pressure set on the FemtoJet was 35hPa for the whole injection experiment to avoid damages on cells ...
-
bioRxiv - Biophysics 2022Quote: ... The probe was controlled with a micromanipulator (Injectman 4; Eppendorf) and mounted on an inverted epifluorescent microscope.
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was centrifuged (Eppendorf 5810R, A-4-62 Rotor) for 10 minutes at 500 x g to separate the remaining blood cells from the plasma.
-
bioRxiv - Molecular Biology 2024Quote: ... followed by high-speed centrifugation (4°C, 12000rpm, Eppendorf, 5424R) for 20 minutes to collect the protein supernatant ...
-
bioRxiv - Biophysics 2021Quote: ... The bicelle mixture (~1 mL) was centrifuged (13,400 rpm, Eppendorf F45-12-11 rotor, 4°C, 30 sec) to remove insoluble debris and the supernatant concentrated to ~200 μL using a 0.5 mL 10 kDa MWCO centrifugal filter (Amicon ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was shaken for 1 hour at 4°C and 1400 rpm in a Thermomixer (Eppendorf, Germany). The samples were spun down at 14000 rpm ...
-
bioRxiv - Molecular Biology 2024Quote: ... with shaking at 1,200 RPM and 4° C for 1 h using a temperature-controlled Thermomixer 22331 (Eppendorf). The beads were pelleted at 500 x g for 1 min and the supernatant removed to become the unbound fraction ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... The rest of the solution was incubated at 4°C for 1 hour on a thermomixer (Eppendorf, Hamburg, Germany) set to 1000 rpm ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The sample was subsequently centrifuged for 1 h at 11,000 x g at 4°C in an Eppendorf tabletop centrifuge 5810R (Eppendorf). The phage pellet was resuspended in 400 μl DNAseI buffer (10 mM Tris-HCl ...
-
bioRxiv - Microbiology 2019Quote: ... four 50 mL aliquots from each trap were centrifuged at 3214 x g and 4°C for 30 minutes (Eppendorf 5810 R, S-4-104 rotor). The supernatant was decanted after centrifugation and cell pellets were stored at −80°C until ready for freeze-drying and lipid extraction ...
-
bioRxiv - Plant Biology 2021Quote: ... samples were centrifuged (20 min, 15,000g, 4°C, in an Eppendorf 5810R centrifuge ...
-
bioRxiv - Genomics 2021Quote: ... and held at 4 C° using the Mastercycler Nexus (Eppendorf, Australia). This was then cycled a total of 40 times ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and centrifuged at 13 000 rpm/15 minutes/4°C (Eppendorf Centrifuge 5415R ...
-
bioRxiv - Molecular Biology 2023Quote: ... Melting curves were obtained on a qPCR machine (Eppendorf RealPlex 4), ramping up from 25 to 95 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... and 10,000 × g at 4 °C for 30 min (Eppendorf 5910R). Pre-cleared supernatants were subjected to ultracentrifugation at 29,000 rpm using a Beckman SW40 Ti rotor (RCFavg ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting supernatant was centrifuged (Eppendorf 5810R, A-4-62 Rotor) for 10 minutes at 500 x g to separate the cells from plasma ...
-
bioRxiv - Microbiology 2024Quote: ... veronii cultures were centrifuged for 4 min at 12,000 rpm (Eppendorf centrifuge 5810R with an F-34-6-38 rotor ...
-
bioRxiv - Cancer Biology 2024Quote: ... or a realplex 4 qPCR 96-Well Real Time Cycler (Eppendorf) with 5% of the immunoprecipitated DNA used in a 20 ul PCR reaction ...
-
bioRxiv - Cancer Biology 2024Quote: ... in a Realplex 4 qPCR 96-Well Real Time Cycler (Eppendorf). Ct values were internally normalized to GAPDH for each sample ...
-
bioRxiv - Biophysics 2022Quote: ... The lysate was incubated for 30 min on a rotating wheel at 4°C and centrifuged at 16 000 g for 20 min at 4°C (Eppendorf centrifuge 5417-R, Rotor F45-30-11). The supernatant was transferred to a fresh 1.5 ml Eppendorf tube and the pellet was discarded ...
-
bioRxiv - Genomics 2022Quote: ... The beads were then incubated 1 h with the anti-Myc antibody (9E10) at 4°C (Eppendorf ThermoMixer, 1,300 rpm), washed three times in PBS/0.1 % BSA and two times in lysis buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 mM D-L methionine) for 1 h at 4° C with shaking at 1400 rpm in a benchtop thermomixer 22331(Eppendorf). The beads were washed twice with binding buffer without soybean trypsin inhibitor and suspended in 50 % v/v binding buffer ...
-
bioRxiv - Evolutionary Biology 2024Quote: 15mL of a Salten solution (1011 PFU/mL) was distributed into 1.5mL polypropylene tubes and centrifuged for 1 hour at 16,000g at 4°C (Eppendorf Centrifuge 5415R). Pellets were resuspended in 100µL of 100 mM of ammonium acetate (NH4-CH3CO2 ...
-
bioRxiv - Cancer Biology 2023Quote: SK-N-BE(2) cells (6000-8000 cells/well) were seeded in 24-well plates (Eppendorf) overnight and prior to treatment with retinoic acid (RA)(10 μM ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... pelleted for 10min (4°C, max speed, Eppendorf 5415 D benchtop centrifuge), dried for ~10min under vacuum ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were harvested by centrifugation (3200 g, 40 min, 4 °C; Eppendorf centrifuge 5810 R ...
-
bioRxiv - Bioengineering 2022Quote: ... By centrifugation (3200 g, 30 min, 4 °C; Eppendorf centrifuge 5810 R), soluble proteins were separated from cell fragments and insoluble proteins ...
-
bioRxiv - Bioengineering 2021Quote: ... This was followed by a 4 h centrifugation step (Eppendorf Centrifuge 5424R) at 21,130 × g and 4°C to remove SWCNT aggregates ...
-
bioRxiv - Immunology 2022Quote: ... centrifuging 400xg for 10 min (Eppendorf Centrifuge 5810R, rotor A-4-62) at room temperature to pellet the cells ...
-
bioRxiv - Microbiology 2021Quote: ... centrifuged at maximum speed for 15 min at 4°C (5804 Eppendorf) to separate phases ...
-
bioRxiv - Genomics 2020Quote: ... and finally held at 4 C° using the Mastercycler Nexus (Eppendorf, Australia). PCR products were then purified with the Zymo DNA Clean & Concentrator Kit™ (Zymo Research ...
-
bioRxiv - Cell Biology 2022Quote: ... Tissue culture plates were centrifuged at 4° C and 500 rcf (Eppendorf 5810 R tabletop centrifuge ...
-
bioRxiv - Cell Biology 2023Quote: ... tissue culture plates were centrifuged at 4° C and 500 rcf (Eppendorf 5810 R tabletop centrifuge ...
-
bioRxiv - Genomics 2023Quote: ... and pelleted (1000 rcf, 10 min at 4°C) (Eppendorf, 5920 R). Pellet was resuspended in 1mL NIM-DP buffer (0.25M sucrose ...
-
bioRxiv - Biochemistry 2019Quote: ... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
bioRxiv - Bioengineering 2019Quote: ... centrifuging for 5 min at 400 rcf (RT, Eppendorf 5430; Rotor: F-35-6-30), re-suspension in fresh medium and transfer to cultivation flask.
-
bioRxiv - Bioengineering 2020Quote: ... and microbubbles were isolated by 4 centrifugation wash cycles at 40 relative centrifugation force for 1 min (Eppendorf 5804, Hamburg, Germany), where the infranatant was discarded and the microbubble concentrate was saved and resuspended.
-
bioRxiv - Bioengineering 2023Quote: ... Cells were stained for 1 hour at a temperature of 4°C with shaking at 600 rpm in a Thermomixer comfort (Eppendorf, Germany). Stained cells were washed with ice cold FACS buffer twice before resuspension in FACS buffer for analysis ...