Labshake search
Citations for Eppendorf :
1 - 50 of 713 citations for 6 cyano 5 methoxy 12 methylindolo 2 3 a carbazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... cells were seeded into 6-well or 12-well polystyrene coated plates (Eppendorf; EP0030720130, EP0030721012) at a density of 0.3 x 106 cells mL−1 or 0.1 x 106 cells mL−1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Neuroscience 2022Quote: ... was added per well using electronic 12-channel pipettes in speed 3 (e12c-pip; Eppendorf). The plates were temporality incubated at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
Multidrug resistance plasmids commonly reprogramme expression of metabolic genes in Escherichia colibioRxiv - Microbiology 2023Quote: ... The 5 ml overnight culture was centrifuged at 8,000 rpm (Eppendorf MiniSpin F-45-12-11) for three minutes ...
-
bioRxiv - Bioengineering 2019Quote: ... centrifuging for 5 min at 400 rcf (RT, Eppendorf 5430; Rotor: F-35-6-30), re-suspension in fresh medium and transfer to cultivation flask.
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Cell Biology 2022Quote: For esiRNA transfection 35,000 U2OS cells were seeded in 2 ml medium in 6-well plates (Eppendorf) the evening before transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... Absorbance was measured at 600 nm after every 12 h intervals till 4 to 5 days using a UV-visible spectrophotometer (Eppendorf).
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 1-5 intact Hydra polyps were incubated per well in a flat bottom 6-well plate (Eppendorf, Hamburg, Germany) filled with 8mL of HM or respective anesthesia ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 12-well plates (Eppendorf) using standard protocols(Debnath et al ...
-
bioRxiv - Biophysics 2020Quote: ... The needle was then glued to a 6×4×2 mm Neodyn magnet (QM-06×04×02-N, Magnets4you) and attached to a motorized micromanipulator (PatchMan, Eppendorf). The magnetic needle was lowered until it touched the bottom of a dummy sample dish and raised again so that it was placed above the bottom of the sample with the very tip in focus around 100 μm above the focus of the glass surface.
-
bioRxiv - Systems Biology 2023Quote: ... 12°C in a ThermoMixer (Eppendorf), and centrifuging for 5 minutes at 12000 rpm ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 million cells were added to a 5 mL DNA LoBind tube (Eppendorf, cat. no. 0030108310), centrifuged at 400 x g for 4 min ...
-
bioRxiv - Systems Biology 2023Quote: ... The samples were then distributed evenly over 2 x 5 mL reaction tubes (Eppendorf, Hamburg, Germany) and spun at 14,200 g for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... 20 mL of the enrichment was transferred to 5 L NMS medium in a 6-L fermenter controlled with a BioFlo® 120 Bioprocess Control Station (Eppendorf, Hamburg, Germany). Gas stream carrying a relatively low CH4 concentration (0.5% v/v in air ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Immunology 2022Quote: ... Purified IgG was digested into F(ab’)2 with 200 μg of IdeS per 10 mg of IgG for 6 hr on a thermal mixer (Eppendorf ThermoMixer C) at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and sonicated in chilled PBS (1 s on ...
-
bioRxiv - Biochemistry 2019Quote: ... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Paleontology 2020Quote: ... 5 mg of bone powder was transferred to a 2 mL Eppendorf® tube (Eppendorf; Westbury, NY, USA) and 1 mL of demineralizing solution (5% trifluoroacetic acid (TFA ...
-
bioRxiv - Developmental Biology 2023Quote: ... the gRNA:Cas9 ribonucleoprotein complex solution was incubated at 37°C for 5 min and then backfilled into 3 microinjection needles using an Eppendorf GELoader tip (Eppendorf, Cat# 022351656). After loading embryos into the embryo holder which covered with 12.5 ppt of salinity water with 0.0001% of methylene blue ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 6–6 droplets for the remaining days) were inoculated into 150-mm Petri dishes (Eppendorf, Hamburg, Germany), and the cells were allowed to attach to the surface for 2 h in a CO2 incubator (5% CO2 and 90% humidity) ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Cell Biology 2020Quote: Germinal vesicle intact oocytes were microinjected with ~5 pL of cRNAs in M2 medium containing milrinone at room temperature with a micromanipulator TransferMan NK 2 (Eppendorf) and picoinjector (Medical Systems Corp.) ...
-
bioRxiv - Microbiology 2023Quote: ... We typically used a 12 channel P200 (Eppendorf explorer, 4861000724). The following items were gathered before pouring the liquid agarose into a reservoir ...
-
bioRxiv - Biophysics 2019Quote: ... 6 mL of the selection culture in 2 mL centrifuge tubes was pelleted at 5000 rpm for 5 minutes at 4°C in a microcentrifuge (Eppendorf, 5242R). The supernatant was removed except for the last ∼200 µL ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were diluted to 2 x 107 cells per mL and 50 µL of each sample was added to 5 mL tubes (Eppendorf, Hamburg, DE), to constitute 1 million cells per flow sample.
-
bioRxiv - Biophysics 2020Quote: ... Supplementary Table 5) were incubated together for 2 h at 37 °C under gentle shaking (450 rpm, Eppendorf ThermoMixer® C, Eppendorf AG, Germany). Unbound DNA origami was removed by placing the tube on a magnet and discarding the supernatant ...
-
bioRxiv - Molecular Biology 2022Quote: ... and incubated at 37LJC overnight (12 hours) with shaking (Eppendorf, Thermomixer C). An additional 5 µL of same concentration Tryp/LysC was added and samples were incubated for another 4 hours ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were spun down (5 min, 800 g•, 2 °C, minimal acceleration and break, Eppendorf 5810 R with swing-×bucket rotor A-4-44). The medium was discarded and the cells were dissociated in 15 mL of ice cold ACK solution (0.15 M NH4Cl ...
-
bioRxiv - Bioengineering 2020Quote: The cjFFs were transfected at P4-6 with Multiporator (Eppendorf) according to the protocol provided by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: ... with an fixed angled-rotor (FA-45-6-30, Eppendorf) and the virus pellet was resuspended in OPC-Sato medium for 1 hour at 4°C on a shaker ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5 % CO2 (Eppendorf). Jurkat CD4-KO cells were derived from wild-type Jurkat T cells (clone E6 ...
-
bioRxiv - Biophysics 2020Quote: 5) Centrifuge (Eppendorf, 5810R)
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Biophysics 2020Quote: ... with three ssDNA overhang strands on a bottom partially complementary to the sequence on the magnetic beads (mag2, Supplementary Table 5) were incubated together for 2 h at 37 °C under gentle shaking (450 rpm, Eppendorf ThermoMixer® C, Eppendorf AG, Germany). Unbound DNA origami was removed by placing the tube on a magnet and discarding the supernatant ...
-
bioRxiv - Biochemistry 2021Quote: ... Unreacted dye was removed by two passages over an equilibrated Bio-spin® 6 column filled with Bio-gel P-6 media in labeling buffer and centrifuged in a tabletop centrifuge (Eppendorf 5810 R, rotor A-4-62) at 1500 rpm for 3 min ...
-
bioRxiv - Biochemistry 2020Quote: ... Debris was removed by centrifugation (Eppendorf Centrifuge 5427 R, Rotor FA-45-12-17) 13k rpm ...