Labshake search
Citations for Eppendorf :
1 - 50 of 144 citations for 6 chloro N 3 methoxypropyl pyridazin 3 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Biophysics 2020Quote: ... The needle was then glued to a 6×4×2 mm Neodyn magnet (QM-06×04×02-N, Magnets4you) and attached to a motorized micromanipulator (PatchMan, Eppendorf). The magnetic needle was lowered until it touched the bottom of a dummy sample dish and raised again so that it was placed above the bottom of the sample with the very tip in focus around 100 μm above the focus of the glass surface.
-
bioRxiv - Immunology 2021Quote: Xela DS2 (passages 120 – 130) and Xela VS2 (passages 125 – 135) (n = 4 independent trials) were seeded in a 6-well plate (Eppendorf) at a cell density of 625,000 cells/well in 1 mL of Xela complete media and allowed to adhere overnight at 26 °C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Microbiology 2019Quote: ... Loaded microfluidic chambers were centrifuged 3 min at 1000 rcf (Eppendorf centrifuge 5430R) to maximize cell adhesion.
-
bioRxiv - Bioengineering 2022Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 tabletop centrifuge) and resuspended ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
High resolution, serial imaging of early mouse and human liver bud morphogenesis in three dimensionsbioRxiv - Developmental Biology 2021Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 table top centrifuge) and resuspended ...
-
bioRxiv - Genomics 2020Quote: ... 3 ml of each bacterial suspension were centrifuged at 6,000 × g (Eppendorf, Westbury, NY) for 2 mins ...
-
bioRxiv - Plant Biology 2020Quote: ... The homogenates were centrifuged at 1,000 g for 3 min (Eppendorf 5430, Hamburg, Germany). The subsequent steps of the RNA extraction were performed on the supernatants according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2019Quote: ... The peptide rOv-GRN-1was concentrated using Centripep with cut-off 3 kDa (Eppendorf) and resuspended in low salt solution ...
-
bioRxiv - Systems Biology 2019Quote: ... and 74.9 °C for 3 minutes in a thermocycler (Mastercycler Pro, Eppendorf, Hamberg, Germany) system as described elsewhere (Jafari et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... for 3 min and then reduced to dryness in a Vacufuge centrifugal concentrator (Eppendorf).
-
bioRxiv - Microbiology 2021Quote: ... and centrifuged for 3 min at 13806 rpm (Centrifuge 5424, FA-45-24-11, Eppendorf) before use ...
-
bioRxiv - Microbiology 2019Quote: ... all culture samples were centrifuged for 3 min at 15871 rcf (Centrifuge 5424, Eppendorf, Germany) in 1.5-mL reaction tubes ...
-
bioRxiv - Bioengineering 2022Quote: ... the purification was carried out in 3 steps using a standard centrifuge (Eppendorf centrifuge 5425). We washed the sample using ethanol and 2 washing buffers provided by the kit ...
-
bioRxiv - Neuroscience 2022Quote: ... was added per well using electronic 12-channel pipettes in speed 3 (e12c-pip; Eppendorf). The plates were temporality incubated at 37°C ...
-
bioRxiv - Systems Biology 2022Quote: ... 3) collected filtrate was evaporated dry over-night in a concentrator (Eppendorf® concentrator plus) under vacuum conditions ...
-
bioRxiv - Systems Biology 2022Quote: ... After denaturation at 78 °C for 3 min on a flatblock thermocycler (Eppendorf, Mastercycler Nexus), samples were incubated at 45 °C for 36–48 hr in a benchtop incubator ...
-
bioRxiv - Genomics 2022Quote: ... Beads and proteins were incubated for 3 hours at 4°C (Eppendorf ThermoMixer, 1,300 rpm). Beads were then washed four times with lysis buffer and recovered in 40 µl of laemmli buffer (50 mM Tris-Cl pH 6.8 ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 ml was aliquoted to each of the duplicate 5.0 mL tubes (Eppendorf Tubes®, Germany) while 50 μL was aliquoted to each of the duplicate 200 μL Polymerase Chain Reaction (PCR ...
-
bioRxiv - Plant Biology 2022Quote: ... Fermentation was conducted in approximately 3 L of culture in a bioreactor BioFlo120 (Eppendorf, Hamburg, Germany) at 30°C for 5 days ...
-
bioRxiv - Genetics 2022Quote: ... and spun at 100x g for 3 min in a swing-bucket centrifuge (e.g., Eppendorf 5804R). The cycling conditions are 95°C for 3 min ...
-
bioRxiv - Microbiology 2023Quote: ... the fermentation broth was centrifuged at 9000 r/min for 3 min (Eppendorf Centrifuge 5424, Germany), and the resultant pellet was collected for bacterial DNA extraction using the FastDNA® Spin Kit for Soil (MP Biomedicals ...
-
bioRxiv - Biochemistry 2021Quote: ... cell cultures were collected by centrifugation at 3,300 rpm for 3 min at 4°C (using Eppendorf centrifuge 5810R equipped with the A-4-62 rotor ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The grown cultures were pelleted using a centrifuge (Eppendorf, 5804 R; 5000 RPM, 22°C, 3 min), washed and re-suspended in 0.8% sterile NaCl solution ...
-
bioRxiv - Microbiology 2022Quote: ... The tip of the remaining 3 swabs were broken off into a 1.5 ml tube (BioPur, Eppendorf) containing 0.3 ml sterile PBS to isolate microbiota.
-
bioRxiv - Cell Biology 2023Quote: ... the expelled homogenate was palleted by centrifugation for 3 min (at 300 g at 4°C) (Eppendorf). The pellet was discarded ...
-
bioRxiv - Systems Biology 2023Quote: ... samples were pelleted at 6,010 x g for 3 minutes using a bench top centrifuge (Eppendorf 5424/5424R). 100% DMSO was added to resuspend the cell pellet with gentle pipetting until the pellet was completely broken down ...
-
bioRxiv - Molecular Biology 2023Quote: ... Yeast were centrifuged at 3,000 rpm for 3 min in an A-4-62 swing bucket rotor (Eppendorf) and resuspended in 20 ml 1 M sorbitol and incubated at 4 °C overnight (<18 h) ...
-
bioRxiv - Molecular Biology 2023Quote: 10xGenomic single cell 3′ library was prepared as follows: single cells were sorted into 1.5 mL tubes (Eppendorf) and counted under the microscope ...
-
bioRxiv - Physiology 2024Quote: ... N = number of sample replicates (groups of n=∼20 tardigrades in a single Eppendorf tube). The majority of samples at -10°C remained unfrozen ...
-
bioRxiv - Synthetic Biology 2020Quote: ... These reactions were incubated for 3 h at 30°C with 500 rpm shaking (Thermo Mixer C, Eppendorf, Germany). Post-incubation ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were eluted in 40 μL of 0.2 M glycine pH 3 for 30 min on a ThermoMixer (Eppendorf) at 900 rpm at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... spun at 13,000 rpm for 3 min and the supernatant transferred to clean 1.5 ml tubes (Eppendorf, Hamburg, Germany). An equal volume of isopropanol (Sigma Aldrich ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...
-
bioRxiv - Molecular Biology 2023Quote: Additional primary chondrifying cell cultures were inoculated onto the surface of 30-mm round cover slips (3×30-μL droplets) (Menzel-Gläser, Menzel GmbH, Braunschweig, Germany) placed in 35-mm Petri dishes (Eppendorf). Hyaline cartilage-specific ECM production in cultures from days 0 to 15 was qualitatively analysed using metachromatic staining ...
-
bioRxiv - Molecular Biology 2023Quote: ... 30- μL droplets of the cell suspension were inoculated onto the surface of 30-mm round cover slips (3 × 30-μL droplets) (Menzel-Gläser) placed in 35-mm Petri dishes (Eppendorf). As described above ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mixture was sonicated 3 times for 1 minute in a waterbath sonicator and incubated in a ThermoMixer (Eppendorf) for 30 minutes at 37°C and 500 rpm ...
-
bioRxiv - Neuroscience 2019Quote: ... The DNA solution was then injected into the subretinal space for 3 seconds at 300 hPa using an automatic injector (Eppendorf). Two injections were performed in the following directions ...
-
bioRxiv - Microbiology 2021Quote: ... 0.5-1 mL culture sample was harvested by centrifugation for 3 min at 13806 rpm (Centrifuge 5424, FA-45-24-11, Eppendorf) and resuspended in 100-500 µL 10 mM NaOH depending on the size of the cell pellet ...