Labshake search
Citations for Eppendorf :
1 - 50 of 473 citations for 6 Methyl 4H pyrido3 2 b1 4oxazin 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... The tip of one swab was broken off into a 2 ml tube (BioPur, Eppendorf) and snap frozen in dry-ice and stored at −80°C ...
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Cell Biology 2022Quote: For esiRNA transfection 35,000 U2OS cells were seeded in 2 ml medium in 6-well plates (Eppendorf) the evening before transfection ...
-
bioRxiv - Biophysics 2020Quote: ... The needle was then glued to a 6×4×2 mm Neodyn magnet (QM-06×04×02-N, Magnets4you) and attached to a motorized micromanipulator (PatchMan, Eppendorf). The magnetic needle was lowered until it touched the bottom of a dummy sample dish and raised again so that it was placed above the bottom of the sample with the very tip in focus around 100 μm above the focus of the glass surface.
-
bioRxiv - Immunology 2022Quote: ... Purified IgG was digested into F(ab’)2 with 200 μg of IdeS per 10 mg of IgG for 6 hr on a thermal mixer (Eppendorf ThermoMixer C) at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... and a volume corresponding to an OD600nm of one (109 cells) was pelleted at 14,000 x g for one minute (Eppendorf MiniSpin). 20 µl of supernatant was mixed with 50 µl BioLux Gaussia Luciferase Assay substrate (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and sonicated in chilled PBS (1 s on ...
-
bioRxiv - Biochemistry 2019Quote: ... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 6–6 droplets for the remaining days) were inoculated into 150-mm Petri dishes (Eppendorf, Hamburg, Germany), and the cells were allowed to attach to the surface for 2 h in a CO2 incubator (5% CO2 and 90% humidity) ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Microbiology 2021Quote: ... tubes were centrifuged one minute at 2,500 x g (Eppendorf MiniSpin) before incubation at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... and coinjected into one-cell stage embryos using a microinjector (Eppendorf). Amplification of the target regions for genotyping was performed using primer pairs 5‘-AGGCACGTATCCTCTTCTGG-3‘ and 3‘-CAAGACGACACATCAGCACA-5‘ for exon 1 in inpp5e ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Microbiology 2021Quote: ... the plates were centrifuged at 1,000 x g for one minute (Eppendorf Centrifuge 5810R with a A-2-DWP-AT plate rotor ...
-
bioRxiv - Microbiology 2020Quote: ... One hundred microliters of sample were loaded into disposable cuvette (Eppendorf 952010077) and analyzed by DLS ...
-
bioRxiv - Genomics 2023Quote: ... One microliter of each cDNA sample was used for TaqMan PCR (Eppendorf RealPlex Mastercycler and Applied Biosystems QuantStudio 3 ...
-
bioRxiv - Neuroscience 2021Quote: ... One single intravitreal injection was carried out using a FemtoJet express microinjector (Eppendorf).
-
bioRxiv - Developmental Biology 2020Quote: ... and transferred to Eppendorf tubes (neural tube tissue from one embryo per Eppendorf) that were snap frozen ...
-
bioRxiv - Neuroscience 2022Quote: ... was injected into one lateral hemisphere of E15.5 embryos using FemtoJet 4i (Eppendorf). Embryonic neural progenitor cells were labelled using the electroporator (ECM 830 ...
-
bioRxiv - Bioengineering 2020Quote: The cjFFs were transfected at P4-6 with Multiporator (Eppendorf) according to the protocol provided by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: ... with an fixed angled-rotor (FA-45-6-30, Eppendorf) and the virus pellet was resuspended in OPC-Sato medium for 1 hour at 4°C on a shaker ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Biochemistry 2021Quote: ... Unreacted dye was removed by two passages over an equilibrated Bio-spin® 6 column filled with Bio-gel P-6 media in labeling buffer and centrifuged in a tabletop centrifuge (Eppendorf 5810 R, rotor A-4-62) at 1500 rpm for 3 min ...
-
bioRxiv - Microbiology 2020Quote: ... One milliliter aliquots of each culture were then centrifuged at 15,000 rpm (Eppendorf Centrifuge 5424) for 1 min and the pellets were resuspended in 1 mL 10% marine broth diluted with sterile seawater ...
-
bioRxiv - Neuroscience 2022Quote: ... Later they were put in 2ml Eppendorf in 70% ethanol (60 flies in one Eppendorf). Flies were first crushed in 150ul of 70% ethanol and then 150ul 70% ethanol was added to crush them more ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Microinjection was carried out in medaka embryos at the one-cell stage using FemtoJet (Eppendorf) and InjectMan NI 2 (Eppendorf) ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL droplets were inoculated into 6-well plates (Eppendorf, Hamburg, Germany). After allowing the cells to adhere to the surface for 2 hours in a CO2 incubator (37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... for 6 h at 37 °C at 800 rpm (shaking incubator, Eppendorf). After RNAse A was removed by centrifugation ...
-
bioRxiv - Neuroscience 2023Quote: ... 100 microglia were sorted and immediately collected in one well of a 96-well plate (Eppendorf) filled with 5 µl cold lysis buffer from the NEBNext® Single Cell/Low Input cDNA Synthesis & Amplification Module (New England Bio Labs ...
-
bioRxiv - Cell Biology 2023Quote: ... The isolated flagella were pelleted one final time at ∼20000xg (14000rpm in an Eppendorf 5417C centrifuge) for 20 min at 4 C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Organoids were transferred to a 6 cm ultra-low-attachment dish (Eppendorf, 30701011) containing Tyrode’s solution (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... were injected into one of the paired olfactory cavities through fine glass capillaries using a pressurized (Eppendorf FemtoJet Express ...
-
bioRxiv - Molecular Biology 2022Quote: One ml of SF per sample was spun in a benchtop centrifuge (Eppendorf non-refrigerated centrifuge 5420) at rpm1400rpm for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... or western blot analysis (200 000 cells in 6-well plates (Eppendorf, cat# 0030720113) were left to attach for 48h ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then seeded in a Matrigel-coated 6-well plate (Eppendorf, cat # 0030720113) to 2.5×106 cells/well with dual SMAD inhibitor media supplemented with Dorsomorphin (1μM ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and InjectMan NI 2 (Eppendorf). Cas9 protein (500 ng/μL) ...
-
bioRxiv - Developmental Biology 2019Quote: ... We have determined that one critical parameter in this process is the use of low-retention 1.5 ml microcentrifuge tubes (e.g., Eppendorf DNA LoBind tubes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The mixture was incubated at 25 °C and 1,500 rpm for one hour by using a ThermoMixer (Eppendorf), and then centrifuged at 14,000 rpm for 10 min ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Genomics 2019Quote: ... One µl of this cocktail was added to the PCR mixture and placed in a thermocycler (Eppendorf MasterCycler Pro). Thermocycling settings were as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... One milliliter of the supernatant was then transferred to new tubes after centrifugation at 14,000 rpm (Eppendorf K-5418R). A total of 1.2 mL of a 10 mM sodium periodate solution (Merck ...