Labshake search
Citations for Eppendorf :
1 - 50 of 169 citations for 6 Methoxy 3 methyl 1H indazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... Reactions were incubated for 1h at 22°C in a thermomixer (Eppendorf) with mixing set to 1000 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reactions were performed on ice for 1h in LoBind tubes (Eppendorf) to minimize protein loss ...
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... followed by another round of centrifugation at 21,000xg 4°C for 1h (Eppendorf, Centrifuge 5424R). Pellets were stored at −70°C ...
-
bioRxiv - Systems Biology 2021Quote: ... Cells were seeded on poly-L-lysine pretreated (0.001%, 1h) 24-well imaging plates (Eppendorf, Germany) at a density of 1e05 cells/well ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mixtures were then incubated at 37°C and 1500 rpm for 1h in a ThermoMixer (Eppendorf) before being subjected to centrifugation for 30 minutes at 15,000 rpm ...
-
bioRxiv - Plant Biology 2023Quote: ... and then were incubated for 1h at 28°C with shaking at 300 rpm (Eppendorf, ThermoMixer C). Samples were diluted 10-fold ...
-
Inhibition of p38-MK2 pathway enhances the efficacy of microtubule inhibitors in breast cancer cellsbioRxiv - Cancer Biology 2024Quote: 6-well dish (Eppendorf) was used for anchorage independent growth assay ...
-
bioRxiv - Microbiology 2024Quote: ... Sera and proteins were incubated for 1h at 37°C at 650-800 rpm in a thermomixer (Eppendorf) to ensure proper agitation ...
-
bioRxiv - Bioengineering 2024Quote: ... nanoparticles were incubated with 55% plasma (with nanoparticles’ concentration of 0.2 mg/ml) for 1h at 37 °C at a constant agitation (total volume: 9’ s1.5 mL Eppendorf tubes). To remove unbound and plasma proteins only loosely attached to the surface of nanoparticles ...
-
bioRxiv - Neuroscience 2022Quote: ... Blood samples were collected on ice and centrifuged within 1h at 4°C for 10min at 3000 RPM (Eppendorf, Centrifuge 5804R). Separated plasma was stored at -80°C until the protein assay was initiated.
-
bioRxiv - Immunology 2023Quote: ... Samples were then washed twice with s-trap loading buffer before addition of 2µg of Trypsin and incubated for 1h on a shaking 47°C incubator (Eppendorf, ThermoMix C). Samples were then removed from the column in a three-step elution with 40µL of TEAB (pH 8 ...
-
bioRxiv - Immunology 2022Quote: ... Samples were then incubated for 1h while shaking at 750 rpm at room temperature in and Eppendorf thermal shaker (Eppendorf, The Netherlands). Following the incubation ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 6–6 droplets for the remaining days) were inoculated into 150-mm Petri dishes (Eppendorf, Hamburg, Germany), and the cells were allowed to attach to the surface for 2 h in a CO2 incubator (5% CO2 and 90% humidity) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Bioengineering 2020Quote: The cjFFs were transfected at P4-6 with Multiporator (Eppendorf) according to the protocol provided by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: ... with an fixed angled-rotor (FA-45-6-30, Eppendorf) and the virus pellet was resuspended in OPC-Sato medium for 1 hour at 4°C on a shaker ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Biochemistry 2021Quote: ... Unreacted dye was removed by two passages over an equilibrated Bio-spin® 6 column filled with Bio-gel P-6 media in labeling buffer and centrifuged in a tabletop centrifuge (Eppendorf 5810 R, rotor A-4-62) at 1500 rpm for 3 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL droplets were inoculated into 6-well plates (Eppendorf, Hamburg, Germany). After allowing the cells to adhere to the surface for 2 hours in a CO2 incubator (37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... for 6 h at 37 °C at 800 rpm (shaking incubator, Eppendorf). After RNAse A was removed by centrifugation ...
-
bioRxiv - Genomics 2024Quote: ... 80 µL H2O) for 6 minutes on a shaker (Eppendorf Thermomixer Comfort) at 28°C and 400 rpm ...
-
bioRxiv - Plant Biology 2024Quote: ... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
bioRxiv - Systems Biology 2024Quote: 20 mL of culture from each of 3 experimental replicates (n = 3) was collected in Protein LoBind tubes (Eppendorf, Hamburg, Germany) by centrifugation at 1650 xg for 10 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... Organoids were transferred to a 6 cm ultra-low-attachment dish (Eppendorf, 30701011) containing Tyrode’s solution (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... or western blot analysis (200 000 cells in 6-well plates (Eppendorf, cat# 0030720113) were left to attach for 48h ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then seeded in a Matrigel-coated 6-well plate (Eppendorf, cat # 0030720113) to 2.5×106 cells/well with dual SMAD inhibitor media supplemented with Dorsomorphin (1μM ...
-
bioRxiv - Genomics 2024Quote: ... 6-8×105 cells were sorted in a 5mL low binding tube (Eppendorf, 0030122356) pre-coated with 1mL of 1X PBS + 0.04%BSA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 10,000 × g for 40 min using with FA-45-6-30 Rotor (Eppendorf, Germany), 100,000 × g ultracentrifugation for 90 min using Himac CP70NE Ultracentrifuge (Himac ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Neuroscience 2024Quote: ... regionalized neural organoids (1-3 organoids per one Eppendorf tube) were transferred into a 1.5 mL Eppendorf tube containing 200 μL of the neural medium ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were seeded into 6-well or 12-well polystyrene coated plates (Eppendorf; EP0030720130, EP0030721012) at a density of 0.3 x 106 cells mL−1 or 0.1 x 106 cells mL−1 ...
-
bioRxiv - Microbiology 2024Quote: ... by centrifugation at 8,000 rpm for 3 mins (Eppendorf 5417C centrifuge). The supernatant was decanted ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and then 6 mL of the culture was collected by centrifugation at 2,500g (5810 R, Eppendorf) for 5 min at room temperature.
-
bioRxiv - Microbiology 2024Quote: An agar plug (6 mm diameter) of the bacterial culture was transferred to a vial (Eppendorf) and extracted with 1 mL of isopropanol ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Synthetic Biology 2022Quote: ... a 6 mL portion of each cell culture was collected by centrifugation at 2,500g (5810 R, Eppendorf) for 5 min at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: For esiRNA transfection 35,000 U2OS cells were seeded in 2 ml medium in 6-well plates (Eppendorf) the evening before transfection ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 tabletop centrifuge) and resuspended ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
bioRxiv - Microbiology 2021Quote: ... Three 6-mm leaf discs from three separate leaves were punched directly into an Eppendorf tube (Eppendorf, Germany) containing 500 μl of CSPL buffer (Omega Bio-Tek ...
-
bioRxiv - Biochemistry 2022Quote: ... Wholemeal flour samples were weighed (6 mg) and transferred into a deep well plate (96/1000 μL, Eppendorf). Phosphate buffered saline (600 μL ...
-
bioRxiv - Molecular Biology 2024Quote: A total of 350,000 HEK293-T cells were seeded in each well of 6-well plates (#EP0030720113, Eppendorf). Transfection was performed the day after at 40-50% cell confluence ...
-
High resolution, serial imaging of early mouse and human liver bud morphogenesis in three dimensionsbioRxiv - Developmental Biology 2021Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 table top centrifuge) and resuspended ...
-
bioRxiv - Genomics 2020Quote: ... 3 ml of each bacterial suspension were centrifuged at 6,000 × g (Eppendorf, Westbury, NY) for 2 mins ...