Labshake search
Citations for Eppendorf :
1 - 50 of 411 citations for 6 Isobutoxy 5 methylpyridine 3 boronic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Bioengineering 2019Quote: ... centrifuging for 5 min at 400 rcf (RT, Eppendorf 5430; Rotor: F-35-6-30), re-suspension in fresh medium and transfer to cultivation flask.
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 1-5 intact Hydra polyps were incubated per well in a flat bottom 6-well plate (Eppendorf, Hamburg, Germany) filled with 8mL of HM or respective anesthesia ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...
-
bioRxiv - Microbiology 2020Quote: ... 20 mL of the enrichment was transferred to 5 L NMS medium in a 6-L fermenter controlled with a BioFlo® 120 Bioprocess Control Station (Eppendorf, Hamburg, Germany). Gas stream carrying a relatively low CH4 concentration (0.5% v/v in air ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Developmental Biology 2023Quote: ... the gRNA:Cas9 ribonucleoprotein complex solution was incubated at 37°C for 5 min and then backfilled into 3 microinjection needles using an Eppendorf GELoader tip (Eppendorf, Cat# 022351656). After loading embryos into the embryo holder which covered with 12.5 ppt of salinity water with 0.0001% of methylene blue ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 6–6 droplets for the remaining days) were inoculated into 150-mm Petri dishes (Eppendorf, Hamburg, Germany), and the cells were allowed to attach to the surface for 2 h in a CO2 incubator (5% CO2 and 90% humidity) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Bioengineering 2020Quote: The cjFFs were transfected at P4-6 with Multiporator (Eppendorf) according to the protocol provided by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: ... with an fixed angled-rotor (FA-45-6-30, Eppendorf) and the virus pellet was resuspended in OPC-Sato medium for 1 hour at 4°C on a shaker ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5 % CO2 (Eppendorf). Jurkat CD4-KO cells were derived from wild-type Jurkat T cells (clone E6 ...
-
bioRxiv - Biophysics 2020Quote: 5) Centrifuge (Eppendorf, 5810R)
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Molecular Biology 2021Quote: ... complete amino acid supplementation) overnight in 96-well flat bottom plates (Eppendorf), diluted into fresh medium with a dilution factor of 200 ...
-
bioRxiv - Biochemistry 2021Quote: ... Unreacted dye was removed by two passages over an equilibrated Bio-spin® 6 column filled with Bio-gel P-6 media in labeling buffer and centrifuged in a tabletop centrifuge (Eppendorf 5810 R, rotor A-4-62) at 1500 rpm for 3 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL droplets were inoculated into 6-well plates (Eppendorf, Hamburg, Germany). After allowing the cells to adhere to the surface for 2 hours in a CO2 incubator (37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... for 6 h at 37 °C at 800 rpm (shaking incubator, Eppendorf). After RNAse A was removed by centrifugation ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 % CO2 using microloaders (Eppendorf). Slices were placed into the incubation chambers one at a time (minimum volume 1.5 ml to cover raised grid) ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA samples were collected in 2.0 ml nucleic acid LoBind tubes (Eppendorf) and stored at −80 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Organoids were transferred to a 6 cm ultra-low-attachment dish (Eppendorf, 30701011) containing Tyrode’s solution (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... transferred in 5 ml tubes (Eppendorf) and 480 μl Triton-X-100 (2% [vol/vol] final concentration ...
-
bioRxiv - Cell Biology 2020Quote: ... or western blot analysis (200 000 cells in 6-well plates (Eppendorf, cat# 0030720113) were left to attach for 48h ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then seeded in a Matrigel-coated 6-well plate (Eppendorf, cat # 0030720113) to 2.5×106 cells/well with dual SMAD inhibitor media supplemented with Dorsomorphin (1μM ...
-
bioRxiv - Immunology 2020Quote: Using 5 mL lo-bind tubes (Eppendorf), 960 μL of ice-cold methanol was added to ~1 mL of protein supernatant and vortexed briefly before subsequent addition of 160 μL of ice-cold chloroform and thorough mixing ...
-
bioRxiv - Neuroscience 2024Quote: ... placed in 5-ml tubes (Eppendorf, 0030119452) and dehydrated 1h in each methanol baths (50% ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were seeded into 6-well or 12-well polystyrene coated plates (Eppendorf; EP0030720130, EP0030721012) at a density of 0.3 x 106 cells mL−1 or 0.1 x 106 cells mL−1 ...
-
bioRxiv - Bioengineering 2022Quote: ... Subsequent washes were performed at a volume of 5 mL in 5 mL Eppendorf tubes (Cat. No. 0030122321, Eppendorf) and pelleted with a compatible microcentrifuge (MC-24™ Touch ...
-
bioRxiv - Cell Biology 2022Quote: ... Eluted lysates in 60% acetonitrile/0.1% formic acid were dried by vacuum centrifugation (Eppendorf; Concentrator Plus) at 45°C.
-
bioRxiv - Biochemistry 2023Quote: ... in 0.3% acetic acid was added to a 96-well plate (CAT# 0030128664, Eppendorf, Hamburg, Germany), sealed with plate seal (CAT# 5010-21951 ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2019Quote: ... incubated for 5 min at 4 °C with rotation and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Microbiology 2019Quote: ... in a 5 mL tube (Eppendorf, Hamburg, Germany). Tubes were kept as cold as possible while in the field (usually for less than 8 h ...
-
bioRxiv - Developmental Biology 2019Quote: ... at 5% CO2 (Eppendorf® New Brunswick Galaxy170S). Media was changed every day and cells were passaged upon reaching 80% confluence ...
-
bioRxiv - Cell Biology 2019Quote: ... shaked for 5 min on a thermomixer (Eppendorf) at room temperature and centrifuged for 20 min at 4°C full speed ...
-
bioRxiv - Microbiology 2023Quote: ... vortexed for 5 min and then centrifuged (Eppendorf Centrifuge model 5810 R ...
-
bioRxiv - Microbiology 2023Quote: ... centrifuging for 5 min at 7,500 rcf (Eppendorf, tabletop centrifuge MiniSpin plus with rotor F-45-12-11) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and then 6 mL of the culture was collected by centrifugation at 2,500g (5810 R, Eppendorf) for 5 min at room temperature.
-
bioRxiv - Synthetic Biology 2022Quote: ... a 6 mL portion of each cell culture was collected by centrifugation at 2,500g (5810 R, Eppendorf) for 5 min at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: For esiRNA transfection 35,000 U2OS cells were seeded in 2 ml medium in 6-well plates (Eppendorf) the evening before transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... 5000 rpm for 5 min in 5415D centrifuge (Eppendorf) to remove aggregates.
-
bioRxiv - Genomics 2022Quote: ... typically a 5 mL Lo-bind tube (0030122348, Eppendorf) or 15 mL falcon tube (229410 ...