Labshake search
Citations for Eppendorf :
1 - 50 of 959 citations for 6 Hydroxy 4 trifluoromethyl 2 3' bipyridine 5 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Biophysics 2020Quote: ... The needle was then glued to a 6×4×2 mm Neodyn magnet (QM-06×04×02-N, Magnets4you) and attached to a motorized micromanipulator (PatchMan, Eppendorf). The magnetic needle was lowered until it touched the bottom of a dummy sample dish and raised again so that it was placed above the bottom of the sample with the very tip in focus around 100 μm above the focus of the glass surface.
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Genomics 2019Quote: ... incubated for 5 min at 4 °C with rotation and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4°C for 5 minutes (Eppendorf centrifuge 5810 R, Rotor S-4-104). Cell pellets were washed with 5 mL D-PBS and centrifugation was repeated ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Biophysics 2019Quote: ... 6 mL of the selection culture in 2 mL centrifuge tubes was pelleted at 5000 rpm for 5 minutes at 4°C in a microcentrifuge (Eppendorf, 5242R). The supernatant was removed except for the last ∼200 µL ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, Eppendorf #A-4-81 rotor) to remove intact cells and debris ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were spun down (5 min, 800 g•, 2 °C, minimal acceleration and break, Eppendorf 5810 R with swing-×bucket rotor A-4-44). The medium was discarded and the cells were dissociated in 15 mL of ice cold ACK solution (0.15 M NH4Cl ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Bioengineering 2019Quote: ... centrifuging for 5 min at 400 rcf (RT, Eppendorf 5430; Rotor: F-35-6-30), re-suspension in fresh medium and transfer to cultivation flask.
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) to remove intact cells and debris ...
-
bioRxiv - Biochemistry 2021Quote: ... Unreacted dye was removed by two passages over an equilibrated Bio-spin® 6 column filled with Bio-gel P-6 media in labeling buffer and centrifuged in a tabletop centrifuge (Eppendorf 5810 R, rotor A-4-62) at 1500 rpm for 3 min ...
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Biochemistry 2020Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, Eppendorf #A-4-81 rotor) and washed with ice-cold 50 mL Binding buffer composed of 10 mM imidazole (pH 7.4) ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBS) and pelleted again (500 × g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were centrifuged at 4°C for 5 minutes (Eppendorf 5417R Refrigerated Centrifuge) at 16,400 rpm ...
-
bioRxiv - Neuroscience 2024Quote: ... samples were centrifuged at 4°C for 5 minutes (Eppendorf 5417R Refrigerated Centrifuge) at 16,400 rpm ...
-
bioRxiv - Genomics 2022Quote: ... Beads and proteins were incubated for 3 hours at 4°C (Eppendorf ThermoMixer, 1,300 rpm). Beads were then washed four times with lysis buffer and recovered in 40 µl of laemmli buffer (50 mM Tris-Cl pH 6.8 ...
-
bioRxiv - Cell Biology 2019Quote: ... The resin was pelleted down by centrifugation at 4°C at 1258 g for 5 min (Eppendorf #A-4-81 rotor) and washed with 25 ml ice-cold binding buffer [10 mM imidazole ...
-
bioRxiv - Biochemistry 2022Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) and washed with ice-cold 50 mL Binding buffer composed of 10mM imidazole (pH 7.4) ...
-
bioRxiv - Immunology 2021Quote: ... lifted cells were centrifuged at 15,000g for 5 minutes at 4°C (Eppendorf 5430R). Cell pellets were placed at −20°C overnight with 60 μL SDS Lysis buffer (1% SDS ...
-
bioRxiv - Genomics 2019Quote: ... in PBS) and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 µL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Cell Biology 2022Quote: For esiRNA transfection 35,000 U2OS cells were seeded in 2 ml medium in 6-well plates (Eppendorf) the evening before transfection ...
-
bioRxiv - Neuroscience 2020Quote: The homogenates were pelleted at 400xg for 6 minutes at 4°C in a swing-bucket rotor centrifuge (Eppendorf). The supernatants were removed and 1 ml ice-cold DPBS (pH 7.3-7.4 ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Biochemistry 2021Quote: ... cell cultures were collected by centrifugation at 3,300 rpm for 3 min at 4°C (using Eppendorf centrifuge 5810R equipped with the A-4-62 rotor ...
-
bioRxiv - Cell Biology 2023Quote: ... the expelled homogenate was palleted by centrifugation for 3 min (at 300 g at 4°C) (Eppendorf). The pellet was discarded ...
-
bioRxiv - Biochemistry 2020Quote: ... The solution was centrifuged at ~3220 g for 5 min (Eppendorf #A-4-81 rotor) to pellet down precipitated dyes ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBS) and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf, RRID:SCR_018092). Nuclei were resuspended in 500 µL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Microbiology 2019Quote: ... centrifuged at 3000 × g for 5 min at 4°C (Centrifuge 5424, Eppendorf, Hamburg, Germany), and frozen at −20°C for bacterial DNA extraction ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 1-5 intact Hydra polyps were incubated per well in a flat bottom 6-well plate (Eppendorf, Hamburg, Germany) filled with 8mL of HM or respective anesthesia ...
-
bioRxiv - Immunology 2021Quote: Xela DS2 (passages 120 – 130) and Xela VS2 (passages 125 – 135) (n = 4 independent trials) were seeded in a 6-well plate (Eppendorf) at a cell density of 625,000 cells/well in 1 mL of Xela complete media and allowed to adhere overnight at 26 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... The tubes were centrifuged at 3000 x g for 6 min at 4 °C and the conditioned media was transferred to a Protein LoBind tube (Eppendorf) (media fraction) ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... Yeast were centrifuged at 3,000 rpm for 3 min in an A-4-62 swing bucket rotor (Eppendorf) and resuspended in 20 ml 1 M sorbitol and incubated at 4 °C overnight (<18 h) ...
-
A DNA-based optical nanosensor for in vivo imaging of acetylcholine in the peripheral nervous systembioRxiv - Bioengineering 2020Quote: The DNA scaffold was self-assembled by incubating 5 DNA oligonucleotides following a temperature gradient from 95 °C to 4 °C for 6 h in a thermocycler (Mastercycler® nexus X2, Eppendorf) in Tris-EDTA buffer (TE buffer ...
-
bioRxiv - Microbiology 2022Quote: Cells (2 ml cultures) were spun down (30 s Eppendorf centrifuge, 14,000 rpm, 4 °C), resuspended in 0.4 ml ice-cold growth medium and added to a screw cap Eppendorf tube containing 1.5 g glass beads (0.1 mm) ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf) and resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Neuroscience 2020Quote: Brain nuclei were pelleted with a swinging bucket centrifuge (500 × g, 5 min, 4°C; 5920R, Eppendorf). Nuclei pellets were resuspended in 1 ml nuclei permeabilization buffer (5 % BSA ...
-
bioRxiv - Genomics 2019Quote: ... Nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf) and resuspended in 500 µL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Genetics 2021Quote: ... nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf) and resuspended in 500 µL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Systems Biology 2023Quote: ... Nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf) and washed with Wash buffer (10 mM Tris-HCL (pH 7.5) ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...