Labshake search
Citations for Eppendorf :
151 - 200 of 900 citations for 6 Hydroxy 2 4 5 triaminopyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The resulting supernatant was centrifuged (Eppendorf 5810R, A-4-62 Rotor) for 10 minutes at 500 x g to separate the cells from plasma ...
-
bioRxiv - Microbiology 2024Quote: ... veronii cultures were centrifuged for 4 min at 12,000 rpm (Eppendorf centrifuge 5810R with an F-34-6-38 rotor ...
-
bioRxiv - Cancer Biology 2024Quote: ... or a realplex 4 qPCR 96-Well Real Time Cycler (Eppendorf) with 5% of the immunoprecipitated DNA used in a 20 ul PCR reaction ...
-
bioRxiv - Cancer Biology 2024Quote: ... in a Realplex 4 qPCR 96-Well Real Time Cycler (Eppendorf). Ct values were internally normalized to GAPDH for each sample ...
-
bioRxiv - Bioengineering 2019Quote: ... The suspension was centrifuged at 500 rcf for 10 min RT (Eppendorf 5430; Rotor: F-35-6-30). These steps were repeated until a white cell pellet was obtained (indicating erythrocyte depletion) ...
-
bioRxiv - Microbiology 2021Quote: ... Three 6-mm leaf discs from three separate leaves were punched directly into an Eppendorf tube (Eppendorf, Germany) containing 500 μl of CSPL buffer (Omega Bio-Tek ...
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Biochemistry 2022Quote: ... Wholemeal flour samples were weighed (6 mg) and transferred into a deep well plate (96/1000 μL, Eppendorf). Phosphate buffered saline (600 μL ...
-
bioRxiv - Molecular Biology 2024Quote: A total of 350,000 HEK293-T cells were seeded in each well of 6-well plates (#EP0030720113, Eppendorf). Transfection was performed the day after at 40-50% cell confluence ...
-
bioRxiv - Cancer Biology 2021Quote: ... 30-70 kDa lane portions were excised into 2×2 mm cubes and transferred to Protein Lo-Bind tubes (Eppendorf). Excised gels were partitioned into tubes ...
-
bioRxiv - Neuroscience 2022Quote: ... Tissues were fixed in 2% paraformaldehyde for 55 minutes at room temperature in 2 mL Protein LoBind tubes (Eppendorf 022431064). Fixative was removed and tissues were washed 4x 10 minutes with 1.5 mL PBS with 0.5% Triton X-100 (PBT) ...
-
bioRxiv - Biochemistry 2019Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Immunology 2021Quote: ... and collected into sterile 2 ml tubes (Eppendorf). All samples were immediately snap frozen in dry ice and stored at –80 °C until DNA extraction.
-
bioRxiv - Biochemistry 2023Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... in individual 2 mL safe-lock tubes (Eppendorf). The suspensions were briefly vortexed to homogeneity and incubated at room temperature for 2 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... connected to a 2 ml microcentrifuge tube (Eppendorf) with an air-tight metal tube cap (P-CAP 2 mL High Pressure ...
-
bioRxiv - Synthetic Biology 2023Quote: ... transferred into 2 mL reaction tubes (Eppendorf, Germany), and frozen at −20 ℃ until further use ...
-
bioRxiv - Biophysics 2022Quote: ... The lysate was incubated for 30 min on a rotating wheel at 4°C and centrifuged at 16 000 g for 20 min at 4°C (Eppendorf centrifuge 5417-R, Rotor F45-30-11). The supernatant was transferred to a fresh 1.5 ml Eppendorf tube and the pellet was discarded ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Bioengineering 2019Quote: ... for 5 minutes at 3,500 RPM (2,465 x g, Eppendorf 5810R v3.3 centrifuge with A-4-62 rotor ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Cell Biology 2023Quote: ... in a 5% CO2 containing humidified incubator (Eppendorf Galaxy 170S) at 37°C.
-
bioRxiv - Biochemistry 2022Quote: ... and incubated with Methoxamine hydrochloride (MeOX-HCl, 2%, 40 μl) at 60 °C for 2 hours at 400 rpm in a thermomixer (Eppendorf, USA). After adding N-methyl-N-(trimethylsilyl ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% P/S on a magnetic separator cells were cultured in fibronectin-coated 6-well plates (Eppendorf, Hamburg, Germany) in DMEM/F-12 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... These reactions were incubated for 0-6 h at 30°C with 500 rpm shaking (Eppendorf, Thermo Mixer C). S ...
-
bioRxiv - Developmental Biology 2019Quote: ... 6 day-old tapeworms were obtained and microinjected with dsRNA using femtotips II via the Femtojet injection system (Eppendorf) to obtain spreading across the first ∼ 3-4 mm anterior of the tapeworm ...
-
bioRxiv - Microbiology 2019Quote: ... Columns were placed into microcentrifuge tubes and incubated for 6 hr at 37 °C in a Thermomixer S (Eppendorf) without shaking ...
-
bioRxiv - Microbiology 2020Quote: ... 0.6 mL culture were centrifuged at 13,350 rpm for 6 min in a Benchtop centrifuge (5424 Eppendorf, Hamburg, Germany). The supernatant was filtered through a 0.22-µm polyvinylidene fluoride syringe filter (Carl Roth ...
-
bioRxiv - Genetics 2019Quote: ... and incubated for 6 days at 20°C while shaking at 200 rpm (New Brunswick I26/I26R shaker, Eppendorf). A stereomicroscope was used to assess developmental stage after 6 days incubation ...
-
bioRxiv - Bioengineering 2023Quote: ... these samples were centrifuged for 6 min at 16,740 x g at room temperature (5427 R, Eppendorf, Hamburg, Germany), and the supernatant was discarded ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... pelleted for 10min (4°C, max speed, Eppendorf 5415 D benchtop centrifuge), dried for ~10min under vacuum ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were harvested by centrifugation (3200 g, 40 min, 4 °C; Eppendorf centrifuge 5810 R ...
-
bioRxiv - Bioengineering 2022Quote: ... By centrifugation (3200 g, 30 min, 4 °C; Eppendorf centrifuge 5810 R), soluble proteins were separated from cell fragments and insoluble proteins ...
-
bioRxiv - Bioengineering 2021Quote: ... This was followed by a 4 h centrifugation step (Eppendorf Centrifuge 5424R) at 21,130 × g and 4°C to remove SWCNT aggregates ...
-
bioRxiv - Immunology 2022Quote: ... centrifuging 400xg for 10 min (Eppendorf Centrifuge 5810R, rotor A-4-62) at room temperature to pellet the cells ...
-
bioRxiv - Microbiology 2021Quote: ... centrifuged at maximum speed for 15 min at 4°C (5804 Eppendorf) to separate phases ...
-
bioRxiv - Genomics 2020Quote: ... and finally held at 4 C° using the Mastercycler Nexus (Eppendorf, Australia). PCR products were then purified with the Zymo DNA Clean & Concentrator Kit™ (Zymo Research ...
-
bioRxiv - Cell Biology 2022Quote: ... Tissue culture plates were centrifuged at 4° C and 500 rcf (Eppendorf 5810 R tabletop centrifuge ...
-
bioRxiv - Cell Biology 2023Quote: ... tissue culture plates were centrifuged at 4° C and 500 rcf (Eppendorf 5810 R tabletop centrifuge ...
-
bioRxiv - Genomics 2023Quote: ... and pelleted (1000 rcf, 10 min at 4°C) (Eppendorf, 5920 R). Pellet was resuspended in 1mL NIM-DP buffer (0.25M sucrose ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were recovered in 1 mL YPD (1% yeast extract, 2% Bacto peptone, 2% D-glucose) at 30°C in a ThermoMixer C (Eppendorf, Hamburg, Germany) for 3 hours (200 RPM ...
-
bioRxiv - Biochemistry 2019Quote: ... Dilutions (1:2) were performed using EP Motion (Eppendorf) and transferred to cells using the Tecan Freedom Evo ...
-
bioRxiv - Neuroscience 2021Quote: ... Each cage contained two 2 mL feeding vials (Eppendorf) pierced with two 2 mm holes at the bottom to allow drinking of the sucrose solutions they contained ...
-
bioRxiv - Systems Biology 2020Quote: ... This biomass suspension in a vial (2 ml, Eppendorf) was thoroughly mixed with pipette and all vials were incubated at 30°C for 45 min under moderate agitation conditions ...