Labshake search
Citations for Eppendorf :
301 - 350 of 770 citations for 6 Ethyl 1H indole 2 3 dione 3 O 4 4 4 trifluoro butyl oxime since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: 96 well plates were coated with immunized vaccine antigen and incubated for two hours at 25 °C (4 μg/mL, in 1xPBS, 50 μL/well) under constant shaking (300 rpm) on a MixMate thermomixer (Eppendorf, USA). ACE2-hFc protein coating was used as a control for antigen immobilization ...
-
bioRxiv - Biophysics 2020Quote: 96 well plates were coated with vaccine antigen and incubated overnight at 25 °C (4 μg/mL in 1x PBS, 50 μl/well) under constant shaking (300 rpm) on a MixMate thermomixer (Eppendorf, USA). Ovalbumin (4 μg/mL in 1x PBS ...
-
bioRxiv - Systems Biology 2019Quote: ... and the bacterial cells were harvested by centrifugation (swing-out rotor A-4-44, Eppendorf; 3220 g, 8 min, 30°C). The cell pellet was resuspended in the mineral medium and centrifuged again ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Solutions were then spun down at 13,000 RPM for 30 minutes at 4°C in a benchtop micro-centrifuge (Eppendorf Centrifuge 5424) to remove cells and other solid debris ...
-
bioRxiv - Neuroscience 2020Quote: ... Tubes were centrifuged at 14k rpm for 15 minutes at 4°C and the aqueous phase was collected into clean 1.5 mL Eppendorf tubes (Eppendorf, Hauppauge, NY). 500 µL of ice-cold isopropanol was added to each tube ...
-
bioRxiv - Microbiology 2020Quote: ... The cultures were grown in BHI broth for 24 h and were centrifuged at 3200 × g for 20 min at 4°C (Eppendorf, 5424R). The cell pellets were transported on ice for proteome analysis at The Mass Spectrometry Centre ...
-
bioRxiv - Bioengineering 2020Quote: ... Cotton swabs containing simulated forensic samples were placed in 500 μL of 1X PBS and mixed at 4°C in a Thermomixer (Eppendorf, Germany) set at 1,000 rpm for approximately an hour ...
-
bioRxiv - Bioengineering 2020Quote: ... and microbubbles were isolated by 4 centrifugation wash cycles at 40 relative centrifugation force for 1 min (Eppendorf 5804, Hamburg, Germany), where the infranatant was discarded and the microbubble concentrate was saved and resuspended.
-
bioRxiv - Neuroscience 2022Quote: ... 3 times with 10” ON and 30” OFF intervals on 20% power on ice and cleared by centrifugation at 21,000 rpm for 20min at 4°C (Eppendorf 5424R Centrifuge). 50µg of supernatant was mixed with NuPAGE LDS Sample Buffer (Thermo Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated (gentle agitation, 20 minutes, 4°C) in EDTA solution (20 mM EDTA-PBS, Ca/Mg-free) in LoBind Protein tubes (Eppendorf 0030122216). The specimen was shaken ...
-
bioRxiv - Developmental Biology 2023Quote: The filled needle is positioned on a micromanipulator (Narishige MMO-4) and connected to a positive pressure pump (Eppendorf FemtoJet 4i). Control embryos were injected with Cas9 protein and Lap2b-GFP mRNA only.
-
bioRxiv - Biophysics 2023Quote: ... Lysate and cell fragments were separated by centrifugation at 4 °C for 20 min at 12,000 rpm (Centrifuge 5418 R, Eppendorf, Hamburg, Germany). Protein concentrations in the supernatant were determined using the Pierce Micro BCA Protein Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... The cell culture supernatant was collected and pre-cleared from cells and larger particles by centrifugation at 400 × g at 4 °C for 10 min (Eppendorf 5810R) and 10,000 × g at 4 °C for 30 min (Eppendorf 5910R) ...
-
bioRxiv - Biochemistry 2023Quote: ... in 5% glucose solution v/v prior to adding 2X solubilization buffer and incubation at 37 °C for 4 hrs under gentle orbital agitation (500 rpm on Eppendorf Thermomixer). The product was then analyzed by SEC as described earlier.
-
bioRxiv - Developmental Biology 2022Quote: ... The filled needle is positioned on a micromanipulator (Narishige MMO-4) and connected to a positive pressure pump (Eppendorf FemtoJet 4i). Embryos are placed in FHM drops covered with mineral oil under Leica TL Led microscope ...
-
bioRxiv - Biophysics 2023Quote: ... 4 µl ATP from the dilution series prepared for the master mix plate (Eppendorf tubes with maximum ATP conc. = 200 µM) were added to row A and row I on reaction stop plate ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were stained for 1 hour at a temperature of 4°C with shaking at 600 rpm in a Thermomixer comfort (Eppendorf, Germany). Stained cells were washed with ice cold FACS buffer twice before resuspension in FACS buffer for analysis ...
-
bioRxiv - Biophysics 2023Quote: ... Centrifugation was used to fractionate the cell lysate (at 4 °C for 30 min at 4,416 g, Eppendorf, Centrifuge 5804 R) and at 4 °C for 1 hour for ultracentrifugation (70,658 g ...
-
bioRxiv - Cell Biology 2023Quote: ... the resuspended cilia were centrifuged at 16000 × g for 10 minutes at 4°C in a microfuge (Eppendorf, Centrifuge 5415 D), and the supernatant was removed ...
-
bioRxiv - Microbiology 2024Quote: ... The stationary pre-cultures were then pooled and washed by centrifugation (5 min, 3,220 g and 4 °C) using a 5810 R swing-out centrifuge (Eppendorf, Hamburg, Germany). After centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... Pellets were washed with cold 70% ethanol and centrifuged at 19,000 × g for 5 min at 4°C and air dried for 15 min in the Centrifugal Vacuum Concentrator 5301 (Eppendorf, USA). The quality of RNA was assessed using a NanoDrop (ND-1000 ...
-
bioRxiv - Microbiology 2024Quote: ... Cells grown under photoautotrophic and dark heterotrophic conditions were collected using centrifugation (6,000 rpm, 10 min, 4°C; R10A2 rotor, Himac CR21F, Eppendorf Himac Technologies) and washed with a small amount of PBS ...
-
bioRxiv - Microbiology 2024Quote: ... The crude EV fractions were prepared by ultracentrifugation (45,000 rpm, 1 h, 4°C; S50A rotor, Himac Ultracentrifuge CS100GXII; Eppendorf Himac Technologies) of the thus prepared supernatants.
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Immunology 2022Quote: ... was added to the cells and they were incubated for 30 min at 4 °C and 750 RPM on a thermomixer (Eppendorf, ThermoMixer C). The liquid in the plate was removed using a vacuum manifold ...
-
bioRxiv - Immunology 2022Quote: ... 20 μL of mAb solution was added to the cells in the filter wells and the cells were incubated for 1 h at 4 °C and 750 RPM on a thermomixer (Eppendorf, ThermoMixer C). After the incubation ...
-
bioRxiv - Immunology 2022Quote: ... was added to the cells and they were incubated for 45 min at 4 °C and 750 RPM on a thermomixer (Eppendorf, ThermoMixer C). The liquid in the plate was removed using a vacuum manifold ...
-
bioRxiv - Molecular Biology 2019Quote: ... The resulting precipitates were centrifuged for 15 minutes at 25000 relative centrifugal force (rcf) in a 5417R Eppendorf centrifuge at 4°C (Eppendorf, Hamburg, Germany). The resultant supernatants were equilibrated to room temperature and then carefully drawn and added into fresh 1.5ml tubes containing 400ml of isopropanol ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell lysate was spun down at 13600 rpm for 10 minutes at 4°C on a table-top microcentrifuge (Eppendorf, Hamburg, Germany). 1 μl was used to determine protein concentration using Bradford dye at 595 nm wavelength ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell lysate was spun down at 13600 rpm for 10 min at 4°C on a table-top microcentrifuge (Eppendorf, Hamburg, Germany). 1 μl was used to determine protein concentration using Bradford dye at 595 nm wavelength ...
-
bioRxiv - Immunology 2021Quote: ... The 80 µL aliquot was lyophilised for 4 h at 30 °C with the aid of a vacuum concentrator (Eppendorf Concentrator 5301) attached to a refrigerated condensation trap (Savant) ...
-
bioRxiv - Biophysics 2020Quote: ... 200 ml of M9 minimal media were added to 4 mL of pre-inoculum and the cell growth was monitored using Biophotometer D30 (Eppendorf, Hamburg, Germany) until the growth rate was 0.8 (OD at 600 nm) ...
-
bioRxiv - Microbiology 2022Quote: ... coli S17-1 that contained the shuttle- or suicide-vector construct at 3700 rpm for 10 min at room temperature (Centrifuge 5920 R, rotor S-4×1000, Eppendorf, Hamburg, Germany). We mixed the E ...
-
bioRxiv - Cell Biology 2020Quote: ... and the cells were pelleted by centrifugation at approximately 250 × g for 5 min at 4 °C (Eppendorf 5804 R, Hamburg, Germany). After resuspension ...
-
bioRxiv - Cell Biology 2021Quote: Live-cell microinjection experiments were performed using a FemtoJet® 4i microinjector in conjunction with an InjectMan® 4 micromanipulation device (Eppendorf). All microinjections were performed using pre-pulled Femtotips® injection capillaries (Eppendorf) ...
-
bioRxiv - Microbiology 2023Quote: Liquid samples in 1 ml were collected and centrifuged for 20 min at 21 130 × g at 4°C (Centrifuge 5424 R; Eppendorf, Hamburg, Germany). The supernatants were used for chemical analyses by applying external standards for calibration and quality control ...
-
bioRxiv - Zoology 2023Quote: ... The homogenates were centrifuged for 10 minutes (860 g at 4 °C) to remove the solid particulates (5810R, Eppendorf centrifuge, Hamburg, Germany) and the supernatant was removed and stored at -80 °C for later analysis [19] ...
-
bioRxiv - Neuroscience 2023Quote: ... freshly laid embryos were aligned against nitrocellulose paper and injected using a quartz capillary needle, three-axis micromanipulator (Narishige, MMO-4) and microinjector (Eppendorf FemtoJet 4X).
-
bioRxiv - Developmental Biology 2023Quote: ... To create extrachromosomal arrays constructs were microinjected into distal gonads of young adults using inverted microscope Leica DMi8 equipped with DIC filters and microinjection system InjectMan® 4 and FemtoJet® 4i (Eppendorf). Microinjection mixtures contained 10 ng/μL of the plasmid of interest ...
-
bioRxiv - Genomics 2023Quote: ... Cells were pelleted by spinning at 800 g for 10 min at 4 °C in a swinging bucket centrifuge (Eppendorf Centrifuge 5810R). The supernatant was gently removed ...
-
bioRxiv - Biophysics 2023Quote: ... This pre-gel solution was kept at 4 °C inside an amber UV-protected 1.5 mL microcentrifuge tube (Eppendorf®, Hauppauge, NY), and degassed for 1 h inside a vacuum chamber to reduce oxygen concentration and prevent early gelation inside the driving syringe while running the experiment ...
-
bioRxiv - Immunology 2023Quote: ... cells were labeled with 50 nM of biotinylated human ACE2 protein (Acro Biosystems, AC2-H82E6) for 30 minutes at 4°C at 700 RPM on a shaker (Eppendorf, ThermoMixer C). The cells were subsequently washed ...
-
bioRxiv - Microbiology 2023Quote: ... We performed fragmentation of 4 µg DNA in a 46-µL elution volume in Covaris G-tubes by centrifuging at 4200–5000 rpm (Eppendorf 5424 centrifuge) for 90 s to achieve fragment sizes of ∼20 kb ...
-
bioRxiv - Cell Biology 2023Quote: ... The sample was placed on ice to incubate for 30 minutes before the demembraned flagella supernatant was removed after centrifugation at 16,000 × g for 10 min at 4°C in a microfuge (Eppendorf, Centrifuge 5415 D). The pellet containing the axoneme was resuspended in 245 μl of Cilia Final Buffer (without trehalose) ...
-
bioRxiv - Genetics 2024Quote: ... The samples were sonicated on ice for 12 to 15 minutes and then centrifuged for 10 minutes at 13200 rpm and 4 °C (Eppendorf centrifuge 5415R) to remove the cell debris ...
-
bioRxiv - Microbiology 2024Quote: ... The culture supernatant was collected by centrifugation (6,000 rpm, 10 min, 4°C; R10A2 rotor, Himac CR21F; Eppendorf Himac Technologies, Hitachinaka, Japan). For cultures grown under photoautotrophic conditions ...
-
bioRxiv - Plant Biology 2019Quote: ... and proteins were concentrated using Amicon ultracentrifugal 30-kDa cut-off filters for 30 min at 4000 x g at 4°C (Eppendorf 5810 R centrifuge). The purified recombinant protein was stored in storage buffer (20 mM HEPES pH 7.5 ...
-
bioRxiv - Plant Biology 2019Quote: ... and proteins were concentrated using Amicon ultracentrifugal 30-kDa cut-off filters for 30 min at 4000 X g at 4°C (Eppendorf 5810 R centrifuge). The purified recombinant protein was stored in storage buffer (20 mM HEPES (pH 7.5) ...