Labshake search
Citations for Eppendorf :
1 - 50 of 729 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... 50 µL of each diluted sample added to 5 mL tubes (Eppendorf, Hamburg, DE), resulting in 1 million cells per flow sample.
-
bioRxiv - Cancer Biology 2024Quote: ... and Master Cycler Pro Device (EPPE6324000.516, Eppendorf, DE). For RT-qPCR ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Developmental Biology 2021Quote: ... diluted 1:250 in 500ul PBSFBT either ON or for 2h at 32°C in a heating block (ThermoMixer C, Eppendorf) with integrated shaking (350rpm) ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were diluted to 2 x 107 cells per mL and 50 µL of each sample was added to 5 mL tubes (Eppendorf, Hamburg, DE), to constitute 1 million cells per flow sample.
-
bioRxiv - Cell Biology 2022Quote: ... 0.1% SDS for 2h at 50°C with shaking at 500rpm using Thermomixer (Eppendorf). Then ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... cells are vigorously mixed in a Mixmate (Eppendorf, Hamburg DE) at 1000 rpm for 2 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... Reactions were incubated for 1h at 22°C in a thermomixer (Eppendorf) with mixing set to 1000 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reactions were performed on ice for 1h in LoBind tubes (Eppendorf) to minimize protein loss ...
-
bioRxiv - Neuroscience 2020Quote: ... Stimulations were performed with automated 8 channel pipettes (Eppendorf, Hamburg, DE) at low dispense speed on heated blocks ...
-
bioRxiv - Bioengineering 2021Quote: ... A microscopic injection station equipped with FemtoJet 4X microinjector (Eppendorf, Hamburg, DE) was used for injections ...
-
bioRxiv - Evolutionary Biology 2023Quote: Genome abundance was determined fluorometrically on a Mastercycler® RealPlex thermocycler (Eppendorf, DE), using the KAPA SYBR® FAST qPCR Master Mix Kit (KAPABIOSYSTEMS ...
-
bioRxiv - Microbiology 2024Quote: ... spore suspensions (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) were directly exposed to either of the two temperatures for two weeks ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... followed by another round of centrifugation at 21,000xg 4°C for 1h (Eppendorf, Centrifuge 5424R). Pellets were stored at −70°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Systems Biology 2021Quote: ... Cells were seeded on poly-L-lysine pretreated (0.001%, 1h) 24-well imaging plates (Eppendorf, Germany) at a density of 1e05 cells/well ...
-
bioRxiv - Neuroscience 2024Quote: ... regionalized neural organoids (1-3 organoids per one Eppendorf tube) were transferred into a 1.5 mL Eppendorf tube containing 200 μL of the neural medium ...
-
bioRxiv - Bioengineering 2022Quote: ... tumors were minced using a razor and digested with 1mg/ml collagenase A and collagenase D and 0.4mg/ml DNase I in PBS at 37°C for 2h with rotation at 600rpm in a thermomixer compact (Eppendorf). 10mM EDTA was then added to stop the enzymatic reaction ...
-
bioRxiv - Biochemistry 2020Quote: ... Microinjection was preformed with Injectman NI2 coupled to the programmable microinjector Femtojet (Eppendorf, Hamburg, DE). The protein was loaded in Femtotips II (Eppendorf ...
-
bioRxiv - Microbiology 2024Quote: ... This mixture was then incubated in a shaking incubator (Innova 44, Eppendorf New Brunswick, DE) at 30°C and 225 rpm for 2–3 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mixtures were then incubated at 37°C and 1500 rpm for 1h in a ThermoMixer (Eppendorf) before being subjected to centrifugation for 30 minutes at 15,000 rpm ...
-
bioRxiv - Plant Biology 2023Quote: ... and then were incubated for 1h at 28°C with shaking at 300 rpm (Eppendorf, ThermoMixer C). Samples were diluted 10-fold ...
-
bioRxiv - Cell Biology 2023Quote: ... Lipids were dissolved and mixed in chloroform and dried using SpeedVac vacuum concentrator (Eppendorf, HH, DE) for 24 hours.
-
bioRxiv - Cell Biology 2022Quote: ... Ten de-yolked embryos were transferred into a 1.5 ml protein low bind-tube (Eppendorf, 0030108116) with the buffer and the number of the embryos was confirmed under a stereoscopic microscope.
-
bioRxiv - Biochemistry 2024Quote: UV-vis spectra were obtained on a Biospectrometer® basic UV-vis spectrophotometer (Eppendorf, Hamburg, DE). Infrared spectra (IR ...
-
bioRxiv - Microbiology 2024Quote: ... Sera and proteins were incubated for 1h at 37°C at 650-800 rpm in a thermomixer (Eppendorf) to ensure proper agitation ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...
-
bioRxiv - Biophysics 2024Quote: All work with EVs is performed utilizing Protein Lo-Bind Eppendorf tubes (Catalog No. 022431081, Eppendorf; DE), and Lo-Bind pipette tips (Corning DeckWorks ...
-
bioRxiv - Microbiology 2024Quote: ... a fraction of the spore suspension (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) was re-suspended in physiological water instead of Milli-Q® Water and stored at 4°C for one week ...
-
bioRxiv - Biochemistry 2024Quote: ... All measurements were made in the 300-600 nm range using a μCuvette G1.0 (Eppendorf, Hamburg, DE) with a 1 mm column length using 3 μL of each solution ...
-
bioRxiv - Bioengineering 2024Quote: ... nanoparticles were incubated with 55% plasma (with nanoparticles’ concentration of 0.2 mg/ml) for 1h at 37 °C at a constant agitation (total volume: 9’ s1.5 mL Eppendorf tubes). To remove unbound and plasma proteins only loosely attached to the surface of nanoparticles ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Biochemistry 2024Quote: All UV-vis absorbance spectra were obtained on a Biospectrometer® basic UV-vis spectrophotometer (Eppendorf, Hamburg, DE) at room temperature ...
-
bioRxiv - Physiology 2020Quote: ... 1% Antibiotic-Antimycotic] in a 5% CO2 incubator (Galaxy 170R, Eppendorf) at 37°C ...
-
bioRxiv - Biophysics 2024Quote: ... Plasma from control and sepsis patients was centrifuged in Protein Lo-Bind Eppendorf tubes (Catalog No. 022431081, Eppendorf; DE) at 5,000 x g for 10 min to remove cells and cell debris ...
-
bioRxiv - Microbiology 2024Quote: ... For −80°C and −20°C, spore suspensions (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) were directly exposed to either of the two temperatures for two weeks ...
-
bioRxiv - Immunology 2023Quote: ... Samples were then washed twice with s-trap loading buffer before addition of 2µg of Trypsin and incubated for 1h on a shaking 47°C incubator (Eppendorf, ThermoMix C). Samples were then removed from the column in a three-step elution with 40µL of TEAB (pH 8 ...
-
bioRxiv - Neuroscience 2022Quote: ... Blood samples were collected on ice and centrifuged within 1h at 4°C for 10min at 3000 RPM (Eppendorf, Centrifuge 5804R). Separated plasma was stored at -80°C until the protein assay was initiated.
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Developmental Biology 2023Quote: ... the gRNA:Cas9 ribonucleoprotein complex solution was incubated at 37°C for 5 min and then backfilled into 3 microinjection needles using an Eppendorf GELoader tip (Eppendorf, Cat# 022351656). After loading embryos into the embryo holder which covered with 12.5 ppt of salinity water with 0.0001% of methylene blue ...
-
bioRxiv - Molecular Biology 2024Quote: ... 25 μL of the eluate was taken out and transferred to a clean 1.5 mL DNA Lobind tube (Eppendorf, DE) (5 μL of the eluate was left behind) ...
-
bioRxiv - Molecular Biology 2024Quote: ... after which 25 μL of the eluate was taken out and transferred to a clean new 1.5 mL DNA Lobind tube (Eppendorf, DE) (5 μL were left behind) ...
-
bioRxiv - Microbiology 2024Quote: ... As a control, a fraction of the spore suspension (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) was re-suspended in physiological water instead of Milli-Q® Water and stored at 4°C for one week ...
-
bioRxiv - Immunology 2022Quote: ... Samples were then incubated for 1h while shaking at 750 rpm at room temperature in and Eppendorf thermal shaker (Eppendorf, The Netherlands). Following the incubation ...
-
bioRxiv - Genomics 2024Quote: ... 1 mL of well-grown culture was centrifuged (5 min, 2040 g; Eppendorf) and the superfluous medium was removed by pipetting ...
-
bioRxiv - Microbiology 2022Quote: ... incubated (1 h) and centrifuged (Eppendorf centrifuge R5810, 4000 rpm for 5 min) for β-galactosidase activity quantification ...
-
bioRxiv - Microbiology 2021Quote: ... the pre‐cultures were incubated at 30°C with a shaking speed of 250 rpm (Innova 44, Eppendorf New Brunswick, DE).
-
bioRxiv - Synthetic Biology 2024Quote: The plasmid DNA pre- and post-assembly was extracted from each of the 21 isolates on an epMotion 5075 TC liquid handler (Eppendorf, Hamburg, DE) using the Zyppy-96 Plasmid MagBead Miniprep Kit (Zymo Research ...
-
bioRxiv - Neuroscience 2024Quote: ... The adjacent 3-5 sections of 100 micron tissue sections were collected in a pre-chilled 2mL microcentrifuge tube (Eppendorf Protein LoBind Tube, Cat #22431102) to total a volume of approximately 40 mg for each donor ...