Labshake search
Citations for Eppendorf :
1 - 50 of 1008 citations for 5 Iodo 1 Triisopropylsilanyl 1H Pyrrolo 2 3 B Pyridine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Malaria parasite HOPS/CORVET complexes are critical for endocytosis and invasion organelles functionbioRxiv - Cell Biology 2024Quote: ... 200 mM hypoxanthine and 2-5% fresh human RBCs (B+; provided by Universität Klinikum Eppendorf, Hamburg). Cultures were maintained at 37 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... Reactions were incubated for 1h at 22°C in a thermomixer (Eppendorf) with mixing set to 1000 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reactions were performed on ice for 1h in LoBind tubes (Eppendorf) to minimize protein loss ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Developmental Biology 2023Quote: ... were mixed in HEPES-CZB medium containing 5 μg/ml cytochalasin B (CB) and injected into the cytoplasm of fertilized eggs using a FemtoJet microinjector (Eppendorf) with constant flow settings ...
-
bioRxiv - Developmental Biology 2024Quote: ... were mixed in HEPES-CZB medium containing 5 μg/ml cytochalasin B (CB) and injected into the cytoplasm of fertilized eggs using a FemtoJet microinjector (Eppendorf) with constant flow settings ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... followed by another round of centrifugation at 21,000xg 4°C for 1h (Eppendorf, Centrifuge 5424R). Pellets were stored at −70°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Systems Biology 2021Quote: ... Cells were seeded on poly-L-lysine pretreated (0.001%, 1h) 24-well imaging plates (Eppendorf, Germany) at a density of 1e05 cells/well ...
-
bioRxiv - Neuroscience 2024Quote: ... regionalized neural organoids (1-3 organoids per one Eppendorf tube) were transferred into a 1.5 mL Eppendorf tube containing 200 μL of the neural medium ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mixtures were then incubated at 37°C and 1500 rpm for 1h in a ThermoMixer (Eppendorf) before being subjected to centrifugation for 30 minutes at 15,000 rpm ...
-
bioRxiv - Plant Biology 2023Quote: ... and then were incubated for 1h at 28°C with shaking at 300 rpm (Eppendorf, ThermoMixer C). Samples were diluted 10-fold ...
-
bioRxiv - Microbiology 2024Quote: ... Sera and proteins were incubated for 1h at 37°C at 650-800 rpm in a thermomixer (Eppendorf) to ensure proper agitation ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 million cells were added to a 5 mL DNA LoBind tube (Eppendorf, cat. no. 0030108310), centrifuged at 400 x g for 4 min ...
-
bioRxiv - Systems Biology 2023Quote: ... The samples were then distributed evenly over 2 x 5 mL reaction tubes (Eppendorf, Hamburg, Germany) and spun at 14,200 g for 15 min ...
-
bioRxiv - Biophysics 2024Quote: ... The requisite number of cells (2− 5 × 105) was pelleted by centrifugation (#5810, Eppendorf, Hamburg, Germany) at 200g for 3 minutes and the supernatant was discarded ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were recovered in 1 mL YPD (1% yeast extract, 2% Bacto peptone, 2% D-glucose) at 30°C in a ThermoMixer C (Eppendorf, Hamburg, Germany) for 3 hours (200 RPM ...
-
bioRxiv - Bioengineering 2024Quote: ... nanoparticles were incubated with 55% plasma (with nanoparticles’ concentration of 0.2 mg/ml) for 1h at 37 °C at a constant agitation (total volume: 9’ s1.5 mL Eppendorf tubes). To remove unbound and plasma proteins only loosely attached to the surface of nanoparticles ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Developmental Biology 2024Quote: ... Another 1 ml of Washing buffer B was added and transferred to 1.5 ml Protein lo-bind tubes (Eppendorf, 0030108116) with beads ...
-
bioRxiv - Physiology 2020Quote: ... 1% Antibiotic-Antimycotic] in a 5% CO2 incubator (Galaxy 170R, Eppendorf) at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and sonicated in chilled PBS (1 s on ...
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Paleontology 2020Quote: ... 5 mg of bone powder was transferred to a 2 mL Eppendorf® tube (Eppendorf; Westbury, NY, USA) and 1 mL of demineralizing solution (5% trifluoroacetic acid (TFA ...
-
bioRxiv - Systems Biology 2024Quote: ... Leaf rosettes were pooled from 5 plants per biological replicate in 2 ml microcentrifuge tubes (Safelock®, Eppendorf) containing two ...
-
bioRxiv - Immunology 2023Quote: ... Samples were then washed twice with s-trap loading buffer before addition of 2µg of Trypsin and incubated for 1h on a shaking 47°C incubator (Eppendorf, ThermoMix C). Samples were then removed from the column in a three-step elution with 40µL of TEAB (pH 8 ...
-
bioRxiv - Neuroscience 2022Quote: ... Blood samples were collected on ice and centrifuged within 1h at 4°C for 10min at 3000 RPM (Eppendorf, Centrifuge 5804R). Separated plasma was stored at -80°C until the protein assay was initiated.
-
bioRxiv - Developmental Biology 2023Quote: ... the gRNA:Cas9 ribonucleoprotein complex solution was incubated at 37°C for 5 min and then backfilled into 3 microinjection needles using an Eppendorf GELoader tip (Eppendorf, Cat# 022351656). After loading embryos into the embryo holder which covered with 12.5 ppt of salinity water with 0.0001% of methylene blue ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Immunology 2022Quote: ... Samples were then incubated for 1h while shaking at 750 rpm at room temperature in and Eppendorf thermal shaker (Eppendorf, The Netherlands). Following the incubation ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Cell Biology 2020Quote: Germinal vesicle intact oocytes were microinjected with ~5 pL of cRNAs in M2 medium containing milrinone at room temperature with a micromanipulator TransferMan NK 2 (Eppendorf) and picoinjector (Medical Systems Corp.) ...
-
bioRxiv - Genomics 2024Quote: ... 1 mL of well-grown culture was centrifuged (5 min, 2040 g; Eppendorf) and the superfluous medium was removed by pipetting ...
-
bioRxiv - Microbiology 2022Quote: ... incubated (1 h) and centrifuged (Eppendorf centrifuge R5810, 4000 rpm for 5 min) for β-galactosidase activity quantification ...
-
bioRxiv - Microbiology 2024Quote: ... The NPA positive was diluted in 2 ml of MEM without FBS and centrifuged at 200Xg for 5 min (HSR Centrifuge Eppendorf Presvac) (NPA supernatant) ...
-
bioRxiv - Neuroscience 2024Quote: ... The adjacent 3-5 sections of 100 micron tissue sections were collected in a pre-chilled 2mL microcentrifuge tube (Eppendorf Protein LoBind Tube, Cat #22431102) to total a volume of approximately 40 mg for each donor ...
-
bioRxiv - Bioengineering 2023Quote: ... MPCs were washed twice for 3 min at 400 RCF at room temperature with PBS supplemented with 1% glucose and 1% pen-strep (Eppendorf 5702R, Hamburg, Germany). Biotinylation of the cell surface was performed by adding 1 mM Sulfo-NHS-LC-Biotin (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... The 1 ml of PBS with the resuspended cells was transferred to a 1·5 ml Protein LoBind tube (Eppendorf), centrifuged at 3000 x g for 6 min at 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were diluted to 2 x 107 cells per mL and 50 µL of each sample was added to 5 mL tubes (Eppendorf, Hamburg, DE), to constitute 1 million cells per flow sample.
-
bioRxiv - Microbiology 2022Quote: ... and incubated for 1 h before centrifugation (Eppendorf centrifuge R5810, 4000 rpm for 5 min), followed by quantification of β-galactosidase activity.
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclei were collected in pre-chilled 1% BSA-blocked 5 mL Protein LoBind tube (Eppendorf) containing the 2% BSA-PBS wash buffer detailed above and kept on ice.