Labshake search
Citations for Eppendorf :
1 - 50 of 549 citations for 3 hydroxy 20 oxopregn 5 en 21 yl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... conditioned media was collected and filtered through Spin-X 0.45 µM cellulose acetate centrifuge tube filter (#8163, Costar) and stored at −20°C in protein Lobind tubes (Eppendorf) until further usage ...
-
bioRxiv - Microbiology 2023Quote: Liquid samples in 1 ml were collected and centrifuged for 20 min at 21 130 × g at 4°C (Centrifuge 5424 R; Eppendorf, Hamburg, Germany). The supernatants were used for chemical analyses by applying external standards for calibration and quality control ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Systems Biology 2024Quote: 20 mL of culture from each of 3 experimental replicates (n = 3) was collected in Protein LoBind tubes (Eppendorf, Hamburg, Germany) by centrifugation at 1650 xg for 10 min ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... then harvested with a sterile cell scraper while at -20°C and transferred to −20 °C cold 5 mL centrifuge tubes (Eppendorf Lo-Bind). After centrifuging the cell-extracts in a 4 °C centrifuge for 5 min at 2000 x g ...
-
bioRxiv - Microbiology 2024Quote: ... the phages were purified by centrifugation (17,000 g and 20 °C for 5 min; Eppendorf 5424 Microcentrifuge ...
-
bioRxiv - Microbiology 2020Quote: ... Reactions and amplifications were carried out as previously described in 1x SYBR qPCR Premix Ex Taq (Tli RNaseH Plus) (Ozyme, St Quentin en Yvelines, France) mix and on a Mastercycler® ep realplex (Eppendorf, Le Pecq, Fr) (Nouri et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Genomics 2024Quote: ... For normal atmospheric oxygen (21% O2) cells were kept in a CO2 incubator (Eppendorf). For hypoxic conditions (0.5% O2 ...
-
bioRxiv - Biochemistry 2022Quote: ... proteins were thawed and spun at 20,000 xg for 5 min at 20°C (Eppendorf microcentrifuge, Germany). The protein concentration was determined by measuring the absorbance at 11 = 280 nm and/or 11 = 488 nm (for GFP-labelled proteins ...
-
bioRxiv - Microbiology 2020Quote: ... and subjected to low-speed centrifugation at 20 × g for 5 min (Centrifuge 5810 R, Eppendorf, Hamburg, Germany) to eliminate gross particulate material ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The ethyl acetate was then evaporated in a rotary evaporator (Concentrator plus, Eppendorf) at 60°C ...
-
bioRxiv - Microbiology 2021Quote: ... The cells were incubated with the dye and shaken for 20 minutes at room temperature in the dark, then washed by centrifugation (3 min, 8000 RPM, 28 °C (Eppendorf 5430R)) and resuspension in M2G three times ...
-
bioRxiv - Neuroscience 2024Quote: ... 300 μL of flow-through from the initial amicon concentration step above (< 3 kDa MWCO) was derivatised (alkylated) with NEM 20 mM and incubated in a thermomixer (Eppendorf, UK) at 25oC for 45 min at 850 rpm in the dark ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...
-
bioRxiv - Genomics 2022Quote: ... 3 mM MgCl2 and 0.1% Tween 20 in water) and centrifuged for 5 min at 500 g in a swinging bucket rotor centrifuge (5920R, Eppendorf). Nuclei pellets were resuspended in 1X Tagmentation Buffer (10 mM Tris pH 7.4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were then centrifuged (20 k g for 5 minutes) and supernatants (F2) were transferred to LoBind Protein tubes (Eppendorf). Protein concentrations were determined using bicinchoninic acid (BCA ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were dislodged from a T75 flask and pelleted via centrifugation at 1300 rpm for 5 minutes at 20 °C (Eppendorf 5804R). The supernatant was aspirated ...
-
bioRxiv - Cell Biology 2023Quote: ... The sample was then concentrated on a 1.2 µm size meshed mixed cellulose ester membrane (Merk) and pelleted using centrifugation for 5 minutes at 1000G and 20°C with a swinging bucket centrifuge (Eppendorf 5427R).
-
bioRxiv - Microbiology 2024Quote: ... the phages were purified by centrifugation (17,000 g and 20 °C for 5 min; Eppendorf 5424 Microcentrifuge; Eppendorf, Mississauga, ON, Canada) and filtration (0.2-µm syringe filters or vacuum filtration system (Corning ...
-
bioRxiv - Systems Biology 2024Quote: ... was recorded and 20 ml of culture were centrifuged at 1,500 x g for 5 minutes at RT (Eppendorf Centrifuge 5810 R). After centrifugation ...
-
bioRxiv - Bioengineering 2021Quote: ... 50 μL of the polymer solution were quickly added using a micropipette (Thermomixer comfort, Eppendorf, 1100 rpm, 21°C) to 450 μL of milliQ water containing a chosen concentration of sodium chloride ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Developmental Biology 2023Quote: ... the gRNA:Cas9 ribonucleoprotein complex solution was incubated at 37°C for 5 min and then backfilled into 3 microinjection needles using an Eppendorf GELoader tip (Eppendorf, Cat# 022351656). After loading embryos into the embryo holder which covered with 12.5 ppt of salinity water with 0.0001% of methylene blue ...
-
bioRxiv - Immunology 2024Quote: ... This slurry was incubated for 1.0 h at 21 °C while shaking at 1,200 rpm on an Eppendorf shaker (Eppendorf, Hamburg, Germany). Excess of CCP4 peptide was removed by washing the beads four times with 1.0 ml PBS ...
-
bioRxiv - Biochemistry 2024Quote: Micropipettes (0.1–2.5, 2–20, 20–200 and 100–1,000 µL; Eppendorf, Cat ...
-
bioRxiv - Biochemistry 2024Quote: Micropipettes (0.1–2.5, 2–20, 20–200 and 100–1,000 µL; Eppendorf, Cat ...
-
bioRxiv - Neuroscience 2023Quote: ... The ethyl acetate (supernatant) was transferred to a new tube and was evaporated (Eppendorf, Concentrator 5301, 30°C). The pellet was then resuspended in 20 μl of diluent ...
-
bioRxiv - Cell Biology 2022Quote: ... Lipids were resuspended in 10 mM methanolic ammonium acetate and transferred to 96-well plates (Eppendorf Twintec 96). Mass spectrometry was performed on a Sciex QTRAP 6500+ mass spectrometer ...
-
bioRxiv - Neuroscience 2020Quote: ... 200 mM solution in water) was then added to the samples and incubated for 4 hours at 21°C in a ThermoMixer (Eppendorf AG). 4 µL of 1M IAA (iodoacetamide in water ...
-
bioRxiv - Neuroscience 2024Quote: ... The adjacent 3-5 sections of 100 micron tissue sections were collected in a pre-chilled 2mL microcentrifuge tube (Eppendorf Protein LoBind Tube, Cat #22431102) to total a volume of approximately 40 mg for each donor ...
-
bioRxiv - Synthetic Biology 2024Quote: The plasmid DNA pre- and post-assembly was extracted from each of the 21 isolates on an epMotion 5075 TC liquid handler (Eppendorf, Hamburg, DE) using the Zyppy-96 Plasmid MagBead Miniprep Kit (Zymo Research ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Genomics 2024Quote: ... we precipitated DNA using 100% ethanol with 100mM of sodium acetate overnight in DNA-lo bind tubes (Eppendorf, Enfield, CT) and then washed twice with 70% ethanol before resuspension in 50µl nuclease free water (QIAGEN) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Zygotes were collected from mated females 21–22[h post-hCG injection and microinjected into the cytoplasm using Eppendorf 5242 microinjector (Eppendorf-Netheler-Hinz GmbH) and Eppendorf Femtotips II capillaries with the following CRISPR cocktail ...
-
bioRxiv - Cell Biology 2021Quote: ... and 20-liter Bioflo IV (Eppendorf) were used for 15-liter working volumes ...
-
bioRxiv - Cell Biology 2021Quote: ... lipid extracts were dissolved in 10 mM ammonium acetate in methanol and transferred to 96-well plates (Eppendorf twintec plate 96). Mass spectrometric measurements were performed in positive ion mode on an AB SCIEX QTRAP 6500+ mass spectrometer ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5 % CO2 (Eppendorf). Jurkat CD4-KO cells were derived from wild-type Jurkat T cells (clone E6 ...
-
bioRxiv - Biophysics 2020Quote: 5) Centrifuge (Eppendorf, 5810R)
-
bioRxiv - Microbiology 2022Quote: ... Two-microliter aliquots of resuspended lipids were diluted 1:10 in 10 mM ammonium acetate in methanol in 96-well plates (Eppendorf twin tec 96) prior to measurement ...
-
bioRxiv - Microbiology 2022Quote: ... Two μl aliquots of the resuspended lipids were diluted 1:10 in 10 mM ammonium acetate in methanol in 96-well plates (Eppendorf twin tec 96) prior to measurement ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Developmental Biology 2022Quote: ... Each ASO (20 µM) and siRNA (20 and 80 µM) was microinjected into the male pronuclei of zygotes using FemtoJet 4i (Eppendorf). All ASO and siRNA sequences used in this study are listed in Supplementary Dataset 5 ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are centrifuged (5 min, 5 000 rpm, pre-cooled 4°C, Eppendorf 5430R) and pellets washed two times (500 mM sucrose ...
-
bioRxiv - Microbiology 2023Quote: ... 200 μl of the sample was mixed with an equal volume of buffered phenol and 20 μl of 20% SDS in a 2 mL centrifuge tube (Eppendorf, Germany). After adding 0.5g of 2 mm zirconia beads (BioSpec Inc. ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated (gentle agitation, 20 minutes, 4°C) in EDTA solution (20 mM EDTA-PBS, Ca/Mg-free) in LoBind Protein tubes (Eppendorf 0030122216). The specimen was shaken ...
-
bioRxiv - Plant Biology 2024Quote: ... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...