Labshake search
Citations for Eppendorf :
1 - 50 of 476 citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and centrifuged for 3 min at 13806 rpm (Centrifuge 5424, FA-45-24-11, Eppendorf) before use ...
-
bioRxiv - Microbiology 2021Quote: ... 0.5-1 mL culture sample was harvested by centrifugation for 3 min at 13806 rpm (Centrifuge 5424, FA-45-24-11, Eppendorf) and resuspended in 100-500 µL 10 mM NaOH depending on the size of the cell pellet ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 0.003% Tricaine (ethyl-3-aminobenzoate-methanesulfonate) for 60 min at 31 °C in a Thermomixer (Eppendorf, Thermomixer R) set to 100 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were seeded into 24-well plates (Eppendorf) one day prior to transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... 24-well cell imaging plates (Eppendorf, EP-0030741005) were coated with the treated or untreated FN ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Black 24-well cell imaging plates (Eppendorf 0030741005) were used to prevent light leaking between wells and sealed with aluminum foil to prevent light leakage and culture spillage and evaporation ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2023Quote: ... in glass-bottomed 24-well plates (Eppendorf, Hamburg, Germany), epidermis down ...
-
bioRxiv - Microbiology 2021Quote: ... All centrifugation steps were performed at 13806 rpm for 5 min (Centrifuge 5424, FA-45-24-11, Eppendorf). Recombinant E ...
-
bioRxiv - Plant Biology 2024Quote: ... Plant tissue was dried at 60°C for 24 hours and homogenized in 5 ml tubes (Eppendorf, Germany) containing 5 ball bearings to very fine and uniform powder ...
-
bioRxiv - Cell Biology 2020Quote: Cells were plated in 24-well glass-bottom plates (Eppendorf) or 8-well microslides (IBIDI ...
-
bioRxiv - Bioengineering 2021Quote: hiPSCs cultured on a glass bottom 24-well plate (Eppendorf) were washed with PBS and fixed with 4% paraformaldehyde (PFA ...
-
bioRxiv - Microbiology 2020Quote: Biofilm formation was assessed in 24-well polystirol plates (Eppendorf) by staining with crystal violet as described earlier in 89 with modifications ...
-
bioRxiv - Bioengineering 2023Quote: ... before and after lyophilization (16-24 hr, Concentrator Plus, Eppendorf), respectively ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Biophysics 2020Quote: ... were incubated for 24 h in a Thermomixer Comfort® (Eppendorf) at 37°C under orbital agitation at 600 rpm ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were plated to glass-bottomed 24-well plates (E0030741021, Eppendorf) and infected at an MOI of 0.5 and incubated for 24 hours ...
-
bioRxiv - Cell Biology 2024Quote: Centrifuge (Eppendorf, model no.5424R; rotor no. FA-45-24-11)
-
bioRxiv - Molecular Biology 2022Quote: ... for 20 minutes (Eppendorf centrifuge 5424 R, Rotor FA-45-24-11). A portion of each lysate (60-100 µL ...
-
bioRxiv - Molecular Biology 2022Quote: ... the explants were placed in a black 24-well plate (Eppendorf, Germany), on top of 1 mL sterile ...
-
bioRxiv - Systems Biology 2021Quote: Cells were seeded into wells of a 24-well glass-bottom plate (Eppendorf) ~12 hours prior to imaging ...
-
bioRxiv - Biophysics 2022Quote: Spherulite samples were stressed for 24 hours and centrifuged (5417R, Eppendorf, Hamburg, Germany) at 14,000 rpm ...
-
bioRxiv - Neuroscience 2021Quote: ... Pooled supernatant was centrifuged (16-24 hours;12,300xg) using a centrifuge (5810R, Eppendorf) with an fixed angled-rotor (FA-45-6-30 ...
-
bioRxiv - Neuroscience 2024Quote: ... and centrifuged at 1000g in swinging buckets (Eppendorf, Rotor S-24-11-AT) at 4°C for 10 minutes.
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Microbiology 2021Quote: ... The supernatant was syringe filtered into an HPLC vial (Eppendorf FA-45-24-11) using a 0.22 μm PVDF filter ...
-
bioRxiv - Biophysics 2023Quote: ... at 37 C between 16 – 24 h at 800 rpm (ThermoMixer C, Eppendorf, Germany). 10 µL of saturated culture was then reset in 1 mL of LB before incubating an additional 2 h ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were grown in 24-well glass bottom plates (170 µm coverglass bottom; Eppendorf, Cellvis). Cells were either left untreated or incubated in the presence of 200 µM oleate-BSA complex or 1 µg/ml triacsin C (Enzo ...
-
bioRxiv - Neuroscience 2021Quote: ... 60,000 hiNPCs/well were plated in 24-well cell imaging plates from Eppendorf (Cat # 0030741005) pre-coated with PLO (0.001% ...
-
bioRxiv - Microbiology 2024Quote: ... an environmental sample was centrifuged (centrifuge 5430R, rotor FA-45-24-11HS; Eppendorf, Hamburg, Germany) at 10,000g for 10 min ...
-
bioRxiv - Systems Biology 2021Quote: ... Cells were seeded on poly-L-lysine pretreated (0.001%, 1h) 24-well imaging plates (Eppendorf, Germany) at a density of 1e05 cells/well ...
-
bioRxiv - Neuroscience 2020Quote: ... 71 cells per mm2 were seeded in wells of a 24-well imaging plate (#0030741021, Eppendorf), that was previously coated with 19 µg/mL laminin (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: SK-N-BE(2) cells (6000-8000 cells/well) were seeded in 24-well plates (Eppendorf) overnight and prior to treatment with retinoic acid (RA)(10 μM ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were plated on 24-well cell imaging plates (black plate with treated glass bottom, Eppendorf) and treated with siRNAs and 100nM nocodazole accordingly ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were plated on 24-well cell imaging plates (black plate with treated glass bottom, Eppendorf) and treated with drugs and/or siRNAs accordingly ...
-
bioRxiv - Genetics 2024Quote: ... Femora were centrifuged for 10min at 13,200rpm (Eppendorf® 5702 Centrifuge with F45-24-11 rotor) to remove marrow ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 times for 5 seconds each to ensure homogenization and centrifuged at 14000 x g for 10 minutes at 4° C (Eppendorf centrifuge 5424 R, FA-45-24-11 rotor). Supernatant was precleared by rotating 20 µl Protein A agarose beads (Cell Signaling #9863 ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Bioengineering 2020Quote: ... The 24-well plate was shaken for 12 h in an orbital shaker (Eppendorf, New Brunswick, USA) at 30°C and at 200 rpm agitation ...
-
bioRxiv - Biochemistry 2022Quote: ... 24 200 µL fractions were collected in a low protein-binding 96-deep-well plate (Eppendorf, Germany). Approximate protein concentrations were estimated using the EZQ™ Protein Quantitation Kit (Thermo Scientific) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Reactions were incubated at 37°C overnight (18-24 h) in ThermoMixer F1.5 (Eppendorf, Cat No. 5384000039) with ThermoTop (Eppendorf ...
-
bioRxiv - Genetics 2021Quote: ... 000 rpm for 10 min at 4°C (Eppendorf 5424R with rotor Eppendorf FA-45-24-11). The supernatant was mixed with Laemmli Buffer containing β-mercaptoethanol and heated at 95°C for 10 min ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were centrifuged at 7800 rpm for 10 min (centrifuge 5430R, rotor FA-45-24-11HS; Eppendorf). The supernatant was filtered through 0.22-μm-pore-size filters (Merck Millipore ...
-
bioRxiv - Genetics 2021Quote: ... 000 rpm for 10 min at 4°C (Eppendorf 5424R with rotor Eppendorf FA-45-24-11). The supernatant was mixed with Laemmli Buffer containing β-mercaptoethanol and heated at 95°C for 10 min ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Microbiology 2022Quote: ... 10 mM MgSO4) centrifuged on the following day (centrifuge 5430R, rotor FA-45-24-11HS; Eppendorf, Hamburg, Germany) at 10,000 g for 10 min ...
-
bioRxiv - Cell Biology 2022Quote: U-2 OS cells were grown in 24-well glass bottom plates (170 µm coverglass bottom; Eppendorf #0030741021) coated with poly-l-lysine and treated with 200 µM oleate-BSA complex for 24 hr ...
-
bioRxiv - Neuroscience 2021Quote: Immunofluorescence microscopy was carried out by seeding out BV2 microglia in a 24-well cell imaging plate (Eppendorf) at a density of 5 × 104 cells/ml ...