Labshake search
Citations for Eppendorf :
1 - 50 of 109 citations for 3 Methoxy Acetaminophen d3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Plant Biology 2024Quote: ... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
bioRxiv - Systems Biology 2024Quote: 20 mL of culture from each of 3 experimental replicates (n = 3) was collected in Protein LoBind tubes (Eppendorf, Hamburg, Germany) by centrifugation at 1650 xg for 10 min ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Neuroscience 2024Quote: ... regionalized neural organoids (1-3 organoids per one Eppendorf tube) were transferred into a 1.5 mL Eppendorf tube containing 200 μL of the neural medium ...
-
bioRxiv - Microbiology 2024Quote: ... by centrifugation at 8,000 rpm for 3 mins (Eppendorf 5417C centrifuge). The supernatant was decanted ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 tabletop centrifuge) and resuspended ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
High resolution, serial imaging of early mouse and human liver bud morphogenesis in three dimensionsbioRxiv - Developmental Biology 2021Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 table top centrifuge) and resuspended ...
-
bioRxiv - Genomics 2020Quote: ... 3 ml of each bacterial suspension were centrifuged at 6,000 × g (Eppendorf, Westbury, NY) for 2 mins ...
-
bioRxiv - Plant Biology 2020Quote: ... The homogenates were centrifuged at 1,000 g for 3 min (Eppendorf 5430, Hamburg, Germany). The subsequent steps of the RNA extraction were performed on the supernatants according to the manufacturer’s specifications ...
-
bioRxiv - Biochemistry 2022Quote: ... for 3 min and then reduced to dryness in a Vacufuge centrifugal concentrator (Eppendorf).
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... and centrifuged for 3 min at 13806 rpm (Centrifuge 5424, FA-45-24-11, Eppendorf) before use ...
-
bioRxiv - Bioengineering 2022Quote: ... the purification was carried out in 3 steps using a standard centrifuge (Eppendorf centrifuge 5425). We washed the sample using ethanol and 2 washing buffers provided by the kit ...
-
bioRxiv - Neuroscience 2022Quote: ... was added per well using electronic 12-channel pipettes in speed 3 (e12c-pip; Eppendorf). The plates were temporality incubated at 37°C ...
-
bioRxiv - Systems Biology 2022Quote: ... 3) collected filtrate was evaporated dry over-night in a concentrator (Eppendorf® concentrator plus) under vacuum conditions ...
-
bioRxiv - Systems Biology 2022Quote: ... After denaturation at 78 °C for 3 min on a flatblock thermocycler (Eppendorf, Mastercycler Nexus), samples were incubated at 45 °C for 36–48 hr in a benchtop incubator ...
-
bioRxiv - Genomics 2022Quote: ... Beads and proteins were incubated for 3 hours at 4°C (Eppendorf ThermoMixer, 1,300 rpm). Beads were then washed four times with lysis buffer and recovered in 40 µl of laemmli buffer (50 mM Tris-Cl pH 6.8 ...
-
bioRxiv - Microbiology 2024Quote: ... The 3mL of homogenized tissue were divided into 3 clean 1.5 mL microcentrifuge tubes (Eppendorf) each with 1 mL of tissue lysate ...
-
bioRxiv - Systems Biology 2024Quote: ... bacterial cultures were centrifuged at 2451 rcf for 3 mins (Centrifuge 5810, Eppendorf, Hamburg, Germany), and the supernatant was taken out and filtered into fresh 50mL tubes using 0.2µm syringe filter (83.1826.001 ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 ml was aliquoted to each of the duplicate 5.0 mL tubes (Eppendorf Tubes®, Germany) while 50 μL was aliquoted to each of the duplicate 200 μL Polymerase Chain Reaction (PCR ...
-
bioRxiv - Plant Biology 2022Quote: ... Fermentation was conducted in approximately 3 L of culture in a bioreactor BioFlo120 (Eppendorf, Hamburg, Germany) at 30°C for 5 days ...
-
bioRxiv - Genetics 2022Quote: ... and spun at 100x g for 3 min in a swing-bucket centrifuge (e.g., Eppendorf 5804R). The cycling conditions are 95°C for 3 min ...
-
bioRxiv - Microbiology 2023Quote: ... the fermentation broth was centrifuged at 9000 r/min for 3 min (Eppendorf Centrifuge 5424, Germany), and the resultant pellet was collected for bacterial DNA extraction using the FastDNA® Spin Kit for Soil (MP Biomedicals ...
-
bioRxiv - Microbiology 2024Quote: ... and 22 h post-induction by centrifugation at 8,000 rpm for 3 min (Eppendorf 5417C centrifuge) and in 3 mL volumes 4 h post-induction by centrifugation at 7,197 x g for 5 min (Sorvall X4RF PRO-MD centrifuge) ...
-
bioRxiv - Bioengineering 2024Quote: ... Stained 3T3 suspension is washed with co-culture media 3 times using a centrifuge (5702, Eppendorf). 3T3 suspension is then added to the keratinocyte dish with a density of 1000 cells/mm^2 ...
-
bioRxiv - Biochemistry 2021Quote: ... cell cultures were collected by centrifugation at 3,300 rpm for 3 min at 4°C (using Eppendorf centrifuge 5810R equipped with the A-4-62 rotor ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The grown cultures were pelleted using a centrifuge (Eppendorf, 5804 R; 5000 RPM, 22°C, 3 min), washed and re-suspended in 0.8% sterile NaCl solution ...
-
bioRxiv - Microbiology 2022Quote: ... The tip of the remaining 3 swabs were broken off into a 1.5 ml tube (BioPur, Eppendorf) containing 0.3 ml sterile PBS to isolate microbiota.
-
bioRxiv - Cell Biology 2023Quote: ... the expelled homogenate was palleted by centrifugation for 3 min (at 300 g at 4°C) (Eppendorf). The pellet was discarded ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the resulting mixture was shaken for 3 h at 65 °C (Eppendorf ThermoMixer C, 1000 rpm). The reaction was quenched by addition of 0.05 M NaHCO3 in water (ca ...
-
bioRxiv - Genomics 2024Quote: ... This was modified to 3 minutes at 37°C with light shaking on a Thermomixer instrument (Eppendorf) at 450rpm ...
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Systems Biology 2023Quote: ... samples were pelleted at 6,010 x g for 3 minutes using a bench top centrifuge (Eppendorf 5424/5424R). 100% DMSO was added to resuspend the cell pellet with gentle pipetting until the pellet was completely broken down ...
-
bioRxiv - Molecular Biology 2023Quote: ... Yeast were centrifuged at 3,000 rpm for 3 min in an A-4-62 swing bucket rotor (Eppendorf) and resuspended in 20 ml 1 M sorbitol and incubated at 4 °C overnight (<18 h) ...
-
bioRxiv - Molecular Biology 2023Quote: 10xGenomic single cell 3′ library was prepared as follows: single cells were sorted into 1.5 mL tubes (Eppendorf) and counted under the microscope ...
-
bioRxiv - Plant Biology 2024Quote: ... The supernatant was then removed and nuclei were gently resuspended in 1.5 ml of HONDA buffer and split into 3 x 1.5 ml DNA LoBind tubes (Eppendorf). Samples were centrifugated at 2,000 g for 10 minutes to pellet nuclei and the supernatant was removed ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Samples were then extracted for 3 hr at 4°C in a ThermoMixer (Eppendorf US, Enfield, CT, USA), followed by evaporation of the methanol component with a speedvac concentrator (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2020Quote: ... These reactions were incubated for 3 h at 30°C with 500 rpm shaking (Thermo Mixer C, Eppendorf, Germany). Post-incubation ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were eluted in 40 μL of 0.2 M glycine pH 3 for 30 min on a ThermoMixer (Eppendorf) at 900 rpm at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... spun at 13,000 rpm for 3 min and the supernatant transferred to clean 1.5 ml tubes (Eppendorf, Hamburg, Germany). An equal volume of isopropanol (Sigma Aldrich ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...