Labshake search
Citations for Eppendorf :
1 - 50 of 485 citations for 3 Chloro 2 6 dinitro indazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Cell Biology 2022Quote: For esiRNA transfection 35,000 U2OS cells were seeded in 2 ml medium in 6-well plates (Eppendorf) the evening before transfection ...
-
bioRxiv - Biophysics 2020Quote: ... The needle was then glued to a 6×4×2 mm Neodyn magnet (QM-06×04×02-N, Magnets4you) and attached to a motorized micromanipulator (PatchMan, Eppendorf). The magnetic needle was lowered until it touched the bottom of a dummy sample dish and raised again so that it was placed above the bottom of the sample with the very tip in focus around 100 μm above the focus of the glass surface.
-
Inhibition of p38-MK2 pathway enhances the efficacy of microtubule inhibitors in breast cancer cellsbioRxiv - Cancer Biology 2024Quote: 6-well dish (Eppendorf) was used for anchorage independent growth assay ...
-
bioRxiv - Immunology 2022Quote: ... Purified IgG was digested into F(ab’)2 with 200 μg of IdeS per 10 mg of IgG for 6 hr on a thermal mixer (Eppendorf ThermoMixer C) at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and sonicated in chilled PBS (1 s on ...
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 6–6 droplets for the remaining days) were inoculated into 150-mm Petri dishes (Eppendorf, Hamburg, Germany), and the cells were allowed to attach to the surface for 2 h in a CO2 incubator (5% CO2 and 90% humidity) ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Bioengineering 2020Quote: The cjFFs were transfected at P4-6 with Multiporator (Eppendorf) according to the protocol provided by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: ... with an fixed angled-rotor (FA-45-6-30, Eppendorf) and the virus pellet was resuspended in OPC-Sato medium for 1 hour at 4°C on a shaker ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Biochemistry 2021Quote: ... Unreacted dye was removed by two passages over an equilibrated Bio-spin® 6 column filled with Bio-gel P-6 media in labeling buffer and centrifuged in a tabletop centrifuge (Eppendorf 5810 R, rotor A-4-62) at 1500 rpm for 3 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL droplets were inoculated into 6-well plates (Eppendorf, Hamburg, Germany). After allowing the cells to adhere to the surface for 2 hours in a CO2 incubator (37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... for 6 h at 37 °C at 800 rpm (shaking incubator, Eppendorf). After RNAse A was removed by centrifugation ...
-
bioRxiv - Genomics 2024Quote: ... 80 µL H2O) for 6 minutes on a shaker (Eppendorf Thermomixer Comfort) at 28°C and 400 rpm ...
-
bioRxiv - Systems Biology 2024Quote: 20 mL of culture from each of 3 experimental replicates (n = 3) was collected in Protein LoBind tubes (Eppendorf, Hamburg, Germany) by centrifugation at 1650 xg for 10 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... Organoids were transferred to a 6 cm ultra-low-attachment dish (Eppendorf, 30701011) containing Tyrode’s solution (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... spore suspensions (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) were directly exposed to either of the two temperatures for two weeks ...
-
bioRxiv - Cell Biology 2020Quote: ... or western blot analysis (200 000 cells in 6-well plates (Eppendorf, cat# 0030720113) were left to attach for 48h ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then seeded in a Matrigel-coated 6-well plate (Eppendorf, cat # 0030720113) to 2.5×106 cells/well with dual SMAD inhibitor media supplemented with Dorsomorphin (1μM ...
-
bioRxiv - Genomics 2024Quote: ... 6-8×105 cells were sorted in a 5mL low binding tube (Eppendorf, 0030122356) pre-coated with 1mL of 1X PBS + 0.04%BSA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 10,000 × g for 40 min using with FA-45-6-30 Rotor (Eppendorf, Germany), 100,000 × g ultracentrifugation for 90 min using Himac CP70NE Ultracentrifuge (Himac ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and InjectMan NI 2 (Eppendorf). Cas9 protein (500 ng/μL) ...
-
bioRxiv - Biophysics 2024Quote: ... a 2 mL tube (Eppendorf), containing 1 mL of a 2% BSA + 0.2% FBS in PBS solution ...
-
bioRxiv - Biophysics 2024Quote: ... A 2 mL tube (Eppendorf), containing a suspended cells at a 5 million per mL concentration in a 2% BSA + 0.2% FBS in PBS solution ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Neuroscience 2024Quote: ... regionalized neural organoids (1-3 organoids per one Eppendorf tube) were transferred into a 1.5 mL Eppendorf tube containing 200 μL of the neural medium ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were seeded into 6-well or 12-well polystyrene coated plates (Eppendorf; EP0030720130, EP0030721012) at a density of 0.3 x 106 cells mL−1 or 0.1 x 106 cells mL−1 ...
-
bioRxiv - Immunology 2022Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was mounted on an Andor Spinning Disc Microscope and microinjection was performed using the microinjector FemtoJet with a 100X oil immersion objective to facilitate immediate visualization and image acquisition after microinjection ...
-
bioRxiv - Microbiology 2024Quote: ... and Mastercycler ep Realplex 2 (Eppendorf). Data was normalized by GAPDH or sigA expression level and all primers were designed using GenScript primer design software ...
-
bioRxiv - Cancer Biology 2024Quote: ... on a RealPlex 2 Thermocycler (Eppendorf).
-
bioRxiv - Cell Biology 2023Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was positioned and microinjection was performed using microinjector (Eppendorf FemtoJet ...
-
bioRxiv - Biochemistry 2024Quote: ... (2) 200 μL pipette (Eppendorf, Germany), (3 ...
-
bioRxiv - Microbiology 2024Quote: ... transferred to 2-ml tubes (Eppendorf), harvested by centrifugation at 7000 x g for 7 minutes and stored at –80°C until DNA isolation (see below).
-
bioRxiv - Microbiology 2024Quote: ... by centrifugation at 8,000 rpm for 3 mins (Eppendorf 5417C centrifuge). The supernatant was decanted ...
-
bioRxiv - Microbiology 2024Quote: ... a fraction of the spore suspension (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) was re-suspended in physiological water instead of Milli-Q® Water and stored at 4°C for one week ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and then 6 mL of the culture was collected by centrifugation at 2,500g (5810 R, Eppendorf) for 5 min at room temperature.
-
bioRxiv - Microbiology 2024Quote: An agar plug (6 mm diameter) of the bacterial culture was transferred to a vial (Eppendorf) and extracted with 1 mL of isopropanol ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...