Labshake search
Citations for Eppendorf :
1 - 50 of 450 citations for 3 7 Diethyl 2 hydrazinoquinoline hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... and incubated with Methoxamine hydrochloride (MeOX-HCl, 2%, 40 μl) at 60 °C for 2 hours at 400 rpm in a thermomixer (Eppendorf, USA). After adding N-methyl-N-(trimethylsilyl ...
-
bioRxiv - Microbiology 2024Quote: ... and incubated with Methoxamine hydrochloride (MeOX-HCl, 2%, 40 μl) at 60°C for 2 hours at 900 rpm in a thermomixer (Eppendorf, USA). After adding N-methyl-N-(trimethylsilyl ...
-
bioRxiv - Plant Biology 2024Quote: ... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and sonicated in chilled PBS (1 s on ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Plant Biology 2021Quote: ... samples were derivatized with N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (Sigma-Aldrich, 1.0 mg per sample, pH 4.0, 60 min, 37 °C under continuous shaking in an Eppendorf thermomixer) and analysed using a UPLC-MS/MS equipped with an electrospray interface in positive mode (ACQUITY ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 g/L tetracycline hydrochloride) was grown in batch mode in a 1 L fermenter (DASGIP 1L Bioreactor, Vaudaux Eppendorf) at pH 7.0 (+/-0.2 ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Microbiology 2021Quote: ... centrifuged at 7000 RPM for 7 min at 4 °C (Eppendorf model 5804R). The supernatant was discarded ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... with ø 7 µm collection capillary and separated by piezo-vibrator PiezoXpert (Eppendorf, Germany). Single-cell state hemocytes were individually transferred to 2.3 µl of lysis buffer (38 ...
-
bioRxiv - Cell Biology 2024Quote: ... and denatured at 85°C for 7 minutes using a ThermoMixer® C-PCR 384 (Eppendorf). After denaturation ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Neuroscience 2021Quote: ... starting from 100 ng of total RNA (RIN ≥7) on an epMotion® 5075 TMX workstation (Eppendorf). Library QC included size distribution check (BioAnalyser ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Systems Biology 2024Quote: 20 mL of culture from each of 3 experimental replicates (n = 3) was collected in Protein LoBind tubes (Eppendorf, Hamburg, Germany) by centrifugation at 1650 xg for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... spore suspensions (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) were directly exposed to either of the two temperatures for two weeks ...
-
bioRxiv - Neuroscience 2024Quote: ... PFFs were generated by incubation at 37°C for 7 days with constant shaking at 1,000 rpm (Eppendorf Thermomixer). After ultracentrifugation for 1 h at 100,000 g ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and InjectMan NI 2 (Eppendorf). Cas9 protein (500 ng/μL) ...
-
bioRxiv - Biophysics 2024Quote: ... a 2 mL tube (Eppendorf), containing 1 mL of a 2% BSA + 0.2% FBS in PBS solution ...
-
bioRxiv - Biophysics 2024Quote: ... A 2 mL tube (Eppendorf), containing a suspended cells at a 5 million per mL concentration in a 2% BSA + 0.2% FBS in PBS solution ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Neuroscience 2024Quote: ... regionalized neural organoids (1-3 organoids per one Eppendorf tube) were transferred into a 1.5 mL Eppendorf tube containing 200 μL of the neural medium ...
-
bioRxiv - Neuroscience 2024Quote: ... by agitation at 1,000 RPM at 37 °C for 7 days in a ThermoMixer® C with ThermoTop® lid (Eppendorf). Pre-formed fibrils (PFFs ...
-
bioRxiv - Immunology 2022Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was mounted on an Andor Spinning Disc Microscope and microinjection was performed using the microinjector FemtoJet with a 100X oil immersion objective to facilitate immediate visualization and image acquisition after microinjection ...
-
bioRxiv - Microbiology 2024Quote: ... and Mastercycler ep Realplex 2 (Eppendorf). Data was normalized by GAPDH or sigA expression level and all primers were designed using GenScript primer design software ...
-
bioRxiv - Cancer Biology 2024Quote: ... on a RealPlex 2 Thermocycler (Eppendorf).
-
bioRxiv - Cell Biology 2023Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was positioned and microinjection was performed using microinjector (Eppendorf FemtoJet ...
-
bioRxiv - Biochemistry 2024Quote: ... (2) 200 μL pipette (Eppendorf, Germany), (3 ...
-
bioRxiv - Microbiology 2024Quote: ... transferred to 2-ml tubes (Eppendorf), harvested by centrifugation at 7000 x g for 7 minutes and stored at –80°C until DNA isolation (see below).
-
bioRxiv - Microbiology 2024Quote: ... by centrifugation at 8,000 rpm for 3 mins (Eppendorf 5417C centrifuge). The supernatant was decanted ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were kept soaked at 37 °C for up to 7 days on an orbital shaker (Excella E24, Eppendorf, Hamburg, Germany) with an agitation rate of 150 rpm ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfected cells were transferred into 8.0 mL of MA2 media in 20 mL culture tubes and allowed to recover while rotating (∼80 rpm) in the outer rim of a tissue culture roller drum (New Brunswick; model TC-7; Eppendorf, USA) housed in an Algatron® incubator (Photon Systems Instruments ...
-
bioRxiv - Biophysics 2023Quote: ... The blood was centrifuged at 250 RCF (relative centrifugal force) and 7 rad/s2 acceleration for 20 min (5810 R, Eppendorf, Hamburg, Germany). The platelet rich plasma (PRP ...
-
bioRxiv - Microbiology 2024Quote: ... a fraction of the spore suspension (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) was re-suspended in physiological water instead of Milli-Q® Water and stored at 4°C for one week ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... using a RealPlex 2 thermocycler (Eppendorf, 2894). All primers were designed and purchased from Integrated DNA Technologies and their sequences are listed in Supplementary file 1.
-
bioRxiv - Microbiology 2024Quote: ... For −80°C and −20°C, spore suspensions (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) were directly exposed to either of the two temperatures for two weeks ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 tabletop centrifuge) and resuspended ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
bioRxiv - Cancer Biology 2021Quote: ... 30-70 kDa lane portions were excised into 2×2 mm cubes and transferred to Protein Lo-Bind tubes (Eppendorf). Excised gels were partitioned into tubes ...
-
bioRxiv - Neuroscience 2022Quote: ... Tissues were fixed in 2% paraformaldehyde for 55 minutes at room temperature in 2 mL Protein LoBind tubes (Eppendorf 022431064). Fixative was removed and tissues were washed 4x 10 minutes with 1.5 mL PBS with 0.5% Triton X-100 (PBT) ...
-
bioRxiv - Microbiology 2024Quote: ... As a control, a fraction of the spore suspension (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) was re-suspended in physiological water instead of Milli-Q® Water and stored at 4°C for one week ...