Labshake search
Citations for Eppendorf :
1 - 50 of 737 citations for 2 Methyl 3 pyrrol 1 yl benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Plant Biology 2024Quote: ... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
bioRxiv - Biochemistry 2022Quote: ... samples were prepared in 96 well microtiter plates by adding 12.5 μL reaction supernatant to 50 μL acetonitrile with 1% v/v trifluoroacetic acid (TFA) followed by centrifugation (2,204 g, 30 min; A-2-DWP rotor, Eppendorf AG, Hamburg, Germany) and transferring of 50 μL centrifugation supernatant into 150 μL MilliQ H2O ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Neuroscience 2024Quote: ... regionalized neural organoids (1-3 organoids per one Eppendorf tube) were transferred into a 1.5 mL Eppendorf tube containing 200 μL of the neural medium ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were recovered in 1 mL YPD (1% yeast extract, 2% Bacto peptone, 2% D-glucose) at 30°C in a ThermoMixer C (Eppendorf, Hamburg, Germany) for 3 hours (200 RPM ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and sonicated in chilled PBS (1 s on ...
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Microbiology 2024Quote: ... 100 µl of formic acid 1% were placed in each Millipore Microcon 30 MRCFOR030 Ultracel PL-30 before centrifugation at 14,500 rpm (Eppendorf 5424 centrifuge) for 15 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... MPCs were washed twice for 3 min at 400 RCF at room temperature with PBS supplemented with 1% glucose and 1% pen-strep (Eppendorf 5702R, Hamburg, Germany). Biotinylation of the cell surface was performed by adding 1 mM Sulfo-NHS-LC-Biotin (Thermo Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mixture was sonicated 3 times for 1 minute in a waterbath sonicator and incubated in a ThermoMixer (Eppendorf) for 30 minutes at 37°C and 500 rpm ...
-
bioRxiv - Microbiology 2022Quote: ... 1 ml of the lung homogenate was added to 2 ml DNA LoBind tubes (Eppendorf) alongside 500 µl sterile killing buffer (20 mM Tris-HCl pH 7.5 ...
-
The conserved membrane-proximal domain of Sbh1/ Sec61β guides signal peptides into the Sec61 channelbioRxiv - Biochemistry 2024Quote: ... Cells (2 OD600) were harvested at 600 x g for 1 min (MiniSpin Centrifuge, Eppendorf) and the supernatants were discarded ...
-
bioRxiv - Biophysics 2022Quote: ... the DNA droplet-containing aqueous phase was layered on top of the oil phase in a volumetric ratio of 1:3 within a microtube (Eppendorf). For the segregation of DNA droplets using enzymatic activity ...
-
bioRxiv - Biophysics 2022Quote: ... The aqueous solution was layered on top of the oil-surfactant mix in a volumetric ratio of 1:3 inside a microtube (Eppendorf). The tube was manually shaken for about 30 s until water-in-oil droplets formed ...
-
bioRxiv - Biophysics 2020Quote: ... the DNA-containing aqueous phase was layered on top of the oil phase in a volumetric ratio of 1:3 within a microtube (Eppendorf). Droplet formation was induced by manual shaking for about 4 s as described earlier.[26] For the oil-phase ...
-
bioRxiv - Genomics 2024Quote: ... and washed in nuclease-free H2O before proceeding to MNase digestion with 1-2U of MNase for 3×106 cells that went on for 1-hour at 37C while shaking in a thermomixer (Eppendorf) at 550rcf ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Microbiology 2020Quote: ... nine 1 mL aliquots were centrifuged for 2 min at 2500 rcf (Eppendorf, Centrifuge 5424 R) and the MOPS-based supernatant removed ...
-
bioRxiv - Molecular Biology 2021Quote: ... complete amino acid supplementation) overnight in 96-well flat bottom plates (Eppendorf), diluted into fresh medium with a dilution factor of 200 ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Plant Biology 2024Quote: ... SDS at a 1:3 (w/v) ratio and extracted by shaking 1000 RPM 95 °C for using a tabletop shaker (Eppendorf ThermoMixer F2.0). Samples were then centrifuged at 20,000 xg for 10 min at room temperature and the supernatant retained in new tubes ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA samples were collected in 2.0 ml nucleic acid LoBind tubes (Eppendorf) and stored at −80 °C ...
-
bioRxiv - Systems Biology 2024Quote: 20 mL of culture from each of 3 experimental replicates (n = 3) was collected in Protein LoBind tubes (Eppendorf, Hamburg, Germany) by centrifugation at 1650 xg for 10 min ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... pH 7.6) and injected into 1 to 2-cell-stage embryos by using a microinjector FemtoJet 5247 (Eppendorf). The sequences and the concentrations of MOs (Gene Tools ...
-
bioRxiv - Neuroscience 2022Quote: ... 1-2 fecal pellets were collected from each mouse by voluntary defecation into a sterile microtube (Eppendorf, Germany) and fecal samples were immediately placed on dry ice ...
-
bioRxiv - Microbiology 2024Quote: ... The collected sample was concentrated in a SpeedVac (45°C, V-AQ, 1-2 hrs) (Eppendorf Concentrator 5301). The samples were stored at 20°C until LC-MS measurement.
-
bioRxiv - Microbiology 2024Quote: ... spore suspensions (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) were directly exposed to either of the two temperatures for two weeks ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1:1v/v mixture of 33% ammonium hydroxide and 40% methylamine in water for 3 h at 37 °C (Eppendorf ThermoMixer C, 1000 rpm). The suspension was filtered ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and InjectMan NI 2 (Eppendorf). Cas9 protein (500 ng/μL) ...
-
bioRxiv - Biophysics 2024Quote: ... a 2 mL tube (Eppendorf), containing 1 mL of a 2% BSA + 0.2% FBS in PBS solution ...
-
bioRxiv - Biophysics 2024Quote: ... A 2 mL tube (Eppendorf), containing a suspended cells at a 5 million per mL concentration in a 2% BSA + 0.2% FBS in PBS solution ...
-
bioRxiv - Immunology 2022Quote: ... For that 2.5x105 cells were incubated with HIV-1 antigens in PBS/2% FCS for the indicated period of times on a 37°C thermomixer (Eppendorf). Cells were then fixed with IC fixation buffer on ice for 30 mins and at RT for additional 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... the mucin beads sampled from different time points were first washed with 1 ml filter-sterilized PBS in 2-ml tubes (Eppendorf). After carefully removing the supernatant ...
-
bioRxiv - Plant Biology 2023Quote: ... benthamiana leaf tissue 5-days post Agrobacterium infiltration was collected using a leaf disc cutter 1 cm in diameter and placed inside a 2 mL safe-lock tube (Eppendorf). Each biological replicate consisted of 4 leaf discs from the same leaf (approximately 40 mg fresh weight) ...
-
bioRxiv - Microbiology 2023Quote: Overnight cultures of the investigated strains were prepared in 1 mL aliquots of TSB in 2 mL microcentrifuge tubes (Eppendorf) which were incubated horizontally with shaking (120 rpm ...
-
bioRxiv - Cell Biology 2023Quote: ... Fractions were collected every three minutes, and fractions were pooled in two passes (1 + 17, 2 + 18 … etc.) and dried in a vacuum centrifuge (Eppendorf). Dried fractions were re-suspended in 0.1% formic acid (FA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Destained gel bands were first cut into small cubes (1-2 mm in each dimension) using a clean scalpel and transferred to new LoBind tubes (Eppendorf). Gel cubes were dehydrated by incubating in 500 μL acetonitrile (ACN ...
-
bioRxiv - Genetics 2022Quote: ... Fractions were collected every three minutes, and fractions were pooled in two passes (1 + 17, 2 + 18 … etc.) and dried in a Speed-Vac (Eppendorf).
-
bioRxiv - Cell Biology 2022Quote: ... Fractions were collected every three minutes, pooled in two passes (fraction 1 + 17, fraction 2 + 18,…, etc.) and dried in a vacuum centrifuge (Eppendorf).
-
bioRxiv - Cell Biology 2022Quote: ... Fractions were collected every three minutes, and fractions were pooled in two passed (1 + 17, 2 + 18 … etc.) and dried in a vacuum centrifuge (Eppendorf). Dried fractions were resuspended in 0.1% formic acid and analyzed on a Orbitrap Lumos Tribrid mass spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... benthamiana leaf tissue 5-days post Agrobacterium infiltration was collected using a leaf disc cutter 1 cm in diameter and placed inside a 2 mL safe-lock tube (Eppendorf). Each biological replicate consisted of 4 leaf discs from the same leaf (approximately 40 mg fresh weight) ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Biochemistry 2023Quote: ... in 0.3% acetic acid was added to a 96-well plate (CAT# 0030128664, Eppendorf, Hamburg, Germany), sealed with plate seal (CAT# 5010-21951 ...