Labshake search
Citations for Eppendorf :
101 - 150 of 1395 citations for 2 Methoxy 2 3 4 5 Tetrabde Unlabeled 50 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... nine 1 mL aliquots were centrifuged for 2 min at 2500 rcf (Eppendorf, Centrifuge 5424 R) and the MOPS-based supernatant removed ...
-
bioRxiv - Biochemistry 2022Quote: ... Unbound lysate was aspirated and the beads transferred to a 2 ml LoBind protein tube (Eppendorf) using 2% SDS wash buffer (150 mM NaCl ...
-
bioRxiv - Genomics 2022Quote: ... 200 µl of cleared lysate was transferred to a new 2 ml tube (Eppendorf 0030 120.094) and used for the robot-assisted protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... Lysates were transferred into a reaction tube (Eppendorf low binding tube, 2 mL, Eppendorf, Hamburg, Germany), followed by addition of 500 µL ice-cold chloroform (CHCl3 ...
-
bioRxiv - Bioengineering 2023Quote: ... a volume of 2 mL of sample was centrifuged in a micro-centrifuge (Eppendorf, Hamburg, Germany) at 10,000⊆g for a period of three minutes ...
-
bioRxiv - Biophysics 2024Quote: ... A 800 μL volume of bacterial suspension was transferred to a 2 ml reaction tube (Eppendorf) and the pH of the suspension (i.e. ...
-
bioRxiv - Neuroscience 2020Quote: ... For bulk PFF production approximately 500μL of 5mg/ml monomeric protein was added to a 2-ml Eppendorf tube and placed on a thermomixer-C (Eppendorf, USA) shaker and incubated at 37°C and 1000RPM for up to 144 hours ...
-
bioRxiv - Genomics 2019Quote: ... incubated for 5 min at 4 °C with rotation and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4°C for 5 minutes (Eppendorf centrifuge 5810 R, Rotor S-4-104). Cell pellets were washed with 5 mL D-PBS and centrifugation was repeated ...
-
bioRxiv - Biophysics 2020Quote: 96 well plates were coated with immunized vaccine antigen and incubated for two hours at 25 °C (4 μg/mL, in 1xPBS, 50 μL/well) under constant shaking (300 rpm) on a MixMate thermomixer (Eppendorf, USA). ACE2-hFc protein coating was used as a control for antigen immobilization ...
-
bioRxiv - Biophysics 2020Quote: 96 well plates were coated with vaccine antigen and incubated overnight at 25 °C (4 μg/mL in 1x PBS, 50 μl/well) under constant shaking (300 rpm) on a MixMate thermomixer (Eppendorf, USA). Ovalbumin (4 μg/mL in 1x PBS ...
-
bioRxiv - Molecular Biology 2019Quote: ... using a Realplex 2 thermocycler (Eppendorf). The PCR conditions were 95°C for 3 min ...
-
bioRxiv - Immunology 2022Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was mounted on an Andor Spinning Disc Microscope and microinjection was performed using the microinjector FemtoJet with a 100X oil immersion objective to facilitate immediate visualization and image acquisition after microinjection ...
-
bioRxiv - Cell Biology 2023Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was positioned and microinjection was performed using microinjector (Eppendorf FemtoJet ...
-
bioRxiv - Cancer Biology 2024Quote: ... on a RealPlex 2 Thermocycler (Eppendorf).
-
bioRxiv - Microbiology 2024Quote: ... and Mastercycler ep Realplex 2 (Eppendorf). Data was normalized by GAPDH or sigA expression level and all primers were designed using GenScript primer design software ...
-
bioRxiv - Biophysics 2020Quote: ... The needle was then glued to a 6×4×2 mm Neodyn magnet (QM-06×04×02-N, Magnets4you) and attached to a motorized micromanipulator (PatchMan, Eppendorf). The magnetic needle was lowered until it touched the bottom of a dummy sample dish and raised again so that it was placed above the bottom of the sample with the very tip in focus around 100 μm above the focus of the glass surface.
-
bioRxiv - Neuroscience 2019Quote: ... Excised gel slices were incubated with 50% acetonitrile/50mM ammonium bicarbonate for 2 h at room temperature or 4°C overnight with gentle shaking at 600 rpm in a Thermomixer (Eppendorf), before being incubated in 100% acetonitrile for 15 min at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... About 6 pl dCas9-KRAB mRNA and sgRNA mixes were injected into cytoplasm of zygotes between 2-4 hpi using a Piezo impact-driven micromanipulator (Eppendorf). For all micro-injection experiments ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Genomics 2021Quote: ... snap-frozen in five aliquots (Safe-Lock cup DNA LoBind 2 ml PCR clean tubes, Eppendorf, #0030108078) and stored at -80 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... and lysed by pipetting for total RNA isolation or collected in 2 ml safe-lock tubes (Eppendorf) in 1x PBS ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Snap-Cap Microcentrifuge Biopur™ Safe-Lock™ or Safe-Lock Tubes 2 mL were from Eppendorf™ ...
-
bioRxiv - Immunology 2022Quote: ... followed by pooling of the eluates and complete drying in 2 mL protein LoBind tubes (#0030108450, Eppendorf). For further purification ...
-
bioRxiv - Immunology 2022Quote: ... 384 wells (the entire plate, including negative controls) were pooled in a single 2 ml tube (Eppendorf). Purification of cDNA was performed by adding 400 μl of cDNA in a 1:1 ratio with SeraMag SpeedBeads in 19% w/v PEG 8,000 in a 1.5 ml LoBind tube ...
-
bioRxiv - Cell Biology 2022Quote: For esiRNA transfection 35,000 U2OS cells were seeded in 2 ml medium in 6-well plates (Eppendorf) the evening before transfection ...
-
bioRxiv - Genomics 2024Quote: ... The resultant DNA was saved in a 2 mL DNA LoBind® Tube (Eppendorf Cat. No. 022431048) at 4 °C until library preparation ...
-
bioRxiv - Genomics 2024Quote: ... The sheared DNA was transferred to a 2 ml DNA LoBind® Tube (Eppendorf Cat. No. 022431048) and temporary stored at 4 °C ...
-
bioRxiv - Genomics 2024Quote: ... The sheared DNA was collected with a 2 ml DNA LoBind® Tube (Eppendorf Cat. No. 022431048) at 4 °C until library preparation ...
-
bioRxiv - Cell Biology 2020Quote: Germinal vesicle intact oocytes were microinjected with ~5 pL of cRNAs in M2 medium containing milrinone at room temperature with a micromanipulator TransferMan NK 2 (Eppendorf) and picoinjector (Medical Systems Corp.) ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Bioengineering 2023Quote: ... The resulting injection micropipette was backfilled with 5-10 μL of 500 μg/mL fluorescein solution and was mounted on the microinjection manipulator (InjectMan 4, Eppendorf) connected to a pneumatic microinjection pump (FemtoJet 4i ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Cell Biology 2023Quote: ... transferred in 5 ml tubes (Eppendorf) and 480 μl Triton-X-100 (2% [vol/vol] final concentration ...
-
bioRxiv - Systems Biology 2021Quote: For the extraction of total proteome 10 mL of each culture were transferred into ice-cold 15 mL Falcon® tubes which were centrifuged immediately at 3000 rpm for 3 min at 4 °C (Eppendorf centrifuge). The supernatant from the centrifugation was discarded and the cell pellets were washed once with 1 mL of cold PBS buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... The collected powder was homogenised and stored in 2 mL protein LoBind tubes (Eppendorf UK Limited, Stevenage, UK) at −80°C until extraction and testing ...
-
bioRxiv - Microbiology 2023Quote: ... two milliliters of the fermentation broth containing the suspended mucin beads were sampled to 2-ml tubes (Eppendorf). The serum bottles were opened and closed carefully each time to avoid contamination in the anaerobic workstation ...
-
bioRxiv - Cancer Biology 2023Quote: ... using a RealPlex 2 thermocycler (Eppendorf, 2894). All primers were designed and purchased from Integrated DNA Technologies and their sequences are listed in Supplementary file 1.
-
bioRxiv - Neuroscience 2021Quote: ... Cells were sorted using a 100 um nozzle (∼20 PSI) into 2 ml protein LoBind Eppendorf tubes (Eppendorf 0030108132) placed in a cooling holder ...
-
bioRxiv - Genomics 2020Quote: ... cultures were diluted to OD ∼ 0.02 in 1.4 mL of LB and were further grown for 2 h at 37°C on a Thermomixer (Eppendorf) with shaking (700 rpm) ...
-
bioRxiv - Biochemistry 2021Quote: ... β-chitin aliquots from the culture flasks were transferred to 2 mL Safe-Lock Eppendorf tubes (Eppendorf, Hamburg, Germany) and boiled directly for 5 min in 30 µL NuPAGE LDS sample buffer and NuPAGE sample reducing agent (Invitrogen™ ...
-
bioRxiv - Evolutionary Biology 2020Quote: GV oocytes were microinjected with ~5 pl of cRNAs in M2 medium (with 2.5 mM milrinone and 3mg/mL BSA) at room temperature (RT) with a micromanipulator TransferMan NK 2 (Eppendorf) and picoinjector (Medical Systems Corp.) ...
-
Phosphoproteomics of cellular mechanosensing reveals NFATC4 as a regulator of myofibroblast activitybioRxiv - Systems Biology 2023Quote: ... cleared by centrifugation and transferred to a clean 2 ml 96-well deep-well plate (DWP, Eppendorf, Hamburg, Germany). TiO2 beads (Titansphere® Phos-TiO Bulk 10 µm ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein LoBind® microtubes (2 mL) and epT.I.P.S.® pipette tips (1000 µL) were purchased from Eppendorf (Hamburg, Germany).
-
bioRxiv - Cell Biology 2023Quote: ... Oocytes were then microinjected with ~5 pl of mRNAs in M2 medium with 2.5 mM milrinone and 3mg/mL BSA at room temperature with a micromanipulator TransferMan NK 2 (Eppendorf) and picoinjector (Medical Systems Corp.) ...
-
bioRxiv - Genomics 2022Quote: ... Supernatant was transferred using a wide-bore pipette to a 2 mL DNA low-bind tube (Eppendorf, Enfield CT), precipitated with 1 mL of 100% ethanol ...
-
bioRxiv - Genomics 2024Quote: ... The resultant DNA was collected and stored in a 2 mL DNA LoBind® Tube (Eppendorf Cat. No. 022431048) at 4 °C until library preparation ...
-
bioRxiv - Molecular Biology 2021Quote: ... Flowrate was adjusted at 2 ml/min to collect peptides in 1 ml fractions in low-protein binding Eppendorf tubes (Eppendorf LoBind tubes, cat. no. EPPE0030108.116). The bound complexes were separated from β2 microglobulin and heavy chain using increasing concentration of buffer B ...
-
bioRxiv - Immunology 2020Quote: Using 5 mL lo-bind tubes (Eppendorf), 960 μL of ice-cold methanol was added to ~1 mL of protein supernatant and vortexed briefly before subsequent addition of 160 μL of ice-cold chloroform and thorough mixing ...
-
bioRxiv - Neuroscience 2024Quote: ... placed in 5-ml tubes (Eppendorf, 0030119452) and dehydrated 1h in each methanol baths (50% ...