Labshake search
Citations for Eppendorf :
1 - 50 of 1284 citations for 2' Chloro 4 5 5 dimethyl 1 3 dioxan 2 yl butyrophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are centrifuged (5 min, 5 000 rpm, pre-cooled 4°C, Eppendorf 5430R) and pellets washed two times (500 mM sucrose ...
-
bioRxiv - Plant Biology 2024Quote: ... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 million cells were added to a 5 mL DNA LoBind tube (Eppendorf, cat. no. 0030108310), centrifuged at 400 x g for 4 min ...
-
bioRxiv - Systems Biology 2023Quote: ... The samples were then distributed evenly over 2 x 5 mL reaction tubes (Eppendorf, Hamburg, Germany) and spun at 14,200 g for 15 min ...
-
Malaria parasite HOPS/CORVET complexes are critical for endocytosis and invasion organelles functionbioRxiv - Cell Biology 2024Quote: ... 200 mM hypoxanthine and 2-5% fresh human RBCs (B+; provided by Universität Klinikum Eppendorf, Hamburg). Cultures were maintained at 37 °C ...
-
bioRxiv - Biophysics 2024Quote: ... The requisite number of cells (2− 5 × 105) was pelleted by centrifugation (#5810, Eppendorf, Hamburg, Germany) at 200g for 3 minutes and the supernatant was discarded ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4°C for 5 minutes (Eppendorf centrifuge 5810 R, Rotor S-4-104). Cell pellets were washed with 5 mL D-PBS and centrifugation was repeated ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Paleontology 2020Quote: ... 5 mg of bone powder was transferred to a 2 mL Eppendorf® tube (Eppendorf; Westbury, NY, USA) and 1 mL of demineralizing solution (5% trifluoroacetic acid (TFA ...
-
bioRxiv - Systems Biology 2024Quote: ... Leaf rosettes were pooled from 5 plants per biological replicate in 2 ml microcentrifuge tubes (Safelock®, Eppendorf) containing two ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Cell Biology 2020Quote: Germinal vesicle intact oocytes were microinjected with ~5 pL of cRNAs in M2 medium containing milrinone at room temperature with a micromanipulator TransferMan NK 2 (Eppendorf) and picoinjector (Medical Systems Corp.) ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, Eppendorf #A-4-81 rotor) to remove intact cells and debris ...
-
bioRxiv - Microbiology 2024Quote: ... The NPA positive was diluted in 2 ml of MEM without FBS and centrifuged at 200Xg for 5 min (HSR Centrifuge Eppendorf Presvac) (NPA supernatant) ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBS) and pelleted again (500 × g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Neuroscience 2024Quote: ... samples were centrifuged at 4°C for 5 minutes (Eppendorf 5417R Refrigerated Centrifuge) at 16,400 rpm ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were centrifuged at 4°C for 5 minutes (Eppendorf 5417R Refrigerated Centrifuge) at 16,400 rpm ...
-
bioRxiv - Microbiology 2024Quote: ... via centrifugation (5-10 min, 3220 rcf, 4°C, Centrifuge 5810 R; Eppendorf). Then the pellet was resuspended thoroughly in ice-cold 1xPBS and fixed by 1:1 dilution in ice-cold absolute ethanol ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were diluted to 2 x 107 cells per mL and 50 µL of each sample was added to 5 mL tubes (Eppendorf, Hamburg, DE), to constitute 1 million cells per flow sample.
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Systems Biology 2023Quote: ... and incubated on ice for 1 min before pelleting with a swinging-bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Supernatant was gently removed and ∼50 µl were left behind to increase nuclei recovery ...
-
bioRxiv - Genomics 2024Quote: ... and incubated on ice for 1 minute before pelleting with a swinging-bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). The supernatant was gently removed and ∼50 µl were left behind to increase nuclei recovery ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) to remove intact cells and debris ...
-
bioRxiv - Immunology 2021Quote: ... lifted cells were centrifuged at 15,000g for 5 minutes at 4°C (Eppendorf 5430R). Cell pellets were placed at −20°C overnight with 60 μL SDS Lysis buffer (1% SDS ...
-
bioRxiv - Cell Biology 2024Quote: ... and pelleted by centrifugation at 0.4xg at 4°C for 5 min (5415R; Eppendorf). Cells were resuspended in TNE buffer and homogenized using a 25-gauge needle ...
-
bioRxiv - Biophysics 2020Quote: ... Supplementary Table 5) were incubated together for 2 h at 37 °C under gentle shaking (450 rpm, Eppendorf ThermoMixer® C, Eppendorf AG, Germany). Unbound DNA origami was removed by placing the tube on a magnet and discarding the supernatant ...
-
bioRxiv - Biochemistry 2020Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, Eppendorf #A-4-81 rotor) and washed with ice-cold 50 mL Binding buffer composed of 10 mM imidazole (pH 7.4) ...
-
bioRxiv - Biochemistry 2020Quote: ... The solution was centrifuged at ~3220 g for 5 min (Eppendorf #A-4-81 rotor) to pellet down precipitated dyes ...
-
bioRxiv - Neuroscience 2020Quote: ... in PBS) and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf, RRID:SCR_018092). Nuclei were resuspended in 500 µL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nuclei were pelleted with a swinging bucket centrifuge (500xg, 5 min, 4°C; 5920R, Eppendorf) and resuspended in 500µL of sort buffer (1% Fatty acid free BSA (7500804 ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were recovered in 1 mL YPD (1% yeast extract, 2% Bacto peptone, 2% D-glucose) at 30°C in a ThermoMixer C (Eppendorf, Hamburg, Germany) for 3 hours (200 RPM ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5 % CO2 (Eppendorf). Jurkat CD4-KO cells were derived from wild-type Jurkat T cells (clone E6 ...
-
bioRxiv - Biophysics 2020Quote: 5) Centrifuge (Eppendorf, 5810R)
-
bioRxiv - Biochemistry 2022Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) and washed with ice-cold 50 mL Binding buffer composed of 10mM imidazole (pH 7.4) ...
-
bioRxiv - Physiology 2020Quote: ... 1% Antibiotic-Antimycotic] in a 5% CO2 incubator (Galaxy 170R, Eppendorf) at 37°C ...
-
bioRxiv - Microbiology 2022Quote: Cells (2 ml cultures) were spun down (30 s Eppendorf centrifuge, 14,000 rpm, 4 °C), resuspended in 0.4 ml ice-cold growth medium and added to a screw cap Eppendorf tube containing 1.5 g glass beads (0.1 mm) ...
-
bioRxiv - Biophysics 2020Quote: ... with three ssDNA overhang strands on a bottom partially complementary to the sequence on the magnetic beads (mag2, Supplementary Table 5) were incubated together for 2 h at 37 °C under gentle shaking (450 rpm, Eppendorf ThermoMixer® C, Eppendorf AG, Germany). Unbound DNA origami was removed by placing the tube on a magnet and discarding the supernatant ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf) and resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Neuroscience 2020Quote: Brain nuclei were pelleted with a swinging bucket centrifuge (500 × g, 5 min, 4°C; 5920R, Eppendorf). Nuclei pellets were resuspended in 1 ml nuclei permeabilization buffer (5 % BSA ...
-
bioRxiv - Genetics 2021Quote: ... nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf) and resuspended in 500 µL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Systems Biology 2023Quote: ... Nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf) and washed with Wash buffer (10 mM Tris-HCL (pH 7.5) ...
-
bioRxiv - Genomics 2024Quote: ... Sysmex) and pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 400 µL of sorting buffer (1% FA-free BSA ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 % CO2 using microloaders (Eppendorf). Slices were placed into the incubation chambers one at a time (minimum volume 1.5 ml to cover raised grid) ...
-
bioRxiv - Genetics 2021Quote: ... Filtered nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf) and resuspended in 1 mL Wash buffer (10mM Tris-HCL (pH 7.5) ...