Labshake search
Citations for Eppendorf :
401 - 450 of 1088 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... typically a 5 mL Lo-bind tube (0030122348, Eppendorf) or 15 mL falcon tube (229410 ...
-
bioRxiv - Neuroscience 2021Quote: ... and CSF was collected with a 20 µl gel loader tip (Eppendorf, shortened), transferred into 0.5 ml polypropylene tubes (Eppendorf ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by heating at 70 °C for 20 min on a Thermomixer (Eppendorf). 30 µl of the reduced lysate was loaded per well on 4-20% or 12% ...
-
bioRxiv - Cell Biology 2024Quote: ... for RERE (30 cycles) and β-ACTIN (20 cycles) using a thermocycler (Eppendorf) and then separated on an agarose gel (Alkali Scientific) ...
-
bioRxiv - Biochemistry 2024Quote: ... 20 µL of serum were added to a 96- well extraction plate (Eppendorf twin.tec® 96-well LoBind® plate ...
-
bioRxiv - Cell Biology 2023Quote: ... for 20 min at 37°C at 800 rpm on a Thermomixer (Eppendorf). The experiment was carried out in a biological triplicate ...
-
bioRxiv - Cancer Biology 2023Quote: ... by centrifugation at 3.000g for 20 min on a 5810R benchtop centrifuge (Eppendorf). The volumes eluted between the 6th and the 20th fractions were collected and processed for cfDNA isolation as previously described [16].
-
bioRxiv - Molecular Biology 2024Quote: ... 1% SDS) for 20 minutes at 70°C in a ThermoMixer F1.5 (Eppendorf). Input samples were brought up to 100 µL in TE with a final concentration of 1% SDS ...
-
bioRxiv - Microbiology 2020Quote: ... 10 g NaCl) in 2 L baffled shake flasks or a 10 L BioFlo 320 Fermenter (Eppendorf) were used to express the I53-50A or I53-50B.4PT1 proteins grown ...
-
bioRxiv - Immunology 2024Quote: ... 10 g NaCl) in 2 L baffled shake flasks or a 10 L BioFlo 320 Fermenter (Eppendorf), were transformed with a I53-50B.4PT1-encoding plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... as previously stated) they were transferred (three-quarters of a T25 flask/well) to non-adherent 24-well plates (Eppendorf, Hamburg, Germany, Cat #0030 722.019). Vero cells were plated in 24-well plates and then exposed to ZIKV at an MOI of 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The citrated blood was mixed by gentle inversion and 8 mL was transferred to a 15 mL LoBind conical tube (Eppendorf), then placed in a heated water bath set to 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were spun at 10,000 g for 15 min (spin 2 in the same Eppendorf FA-45-48-11 rotor) and the resulting supernatant is the tissue lysate (TL ...
-
bioRxiv - Cell Biology 2022Quote: ... then with 150 µl of 100% acetonitrile to the gel pieces for 15 min at 25°C while being agitated at 1400 rpm in a ThermoMixer (Eppendorf). Extracted peptides combined ...
-
bioRxiv - Physiology 2021Quote: ... centrifuged at 14,000 rpm for 15 minutes and 120 µL of the supernatant was transferred to a 96 well autosampler plate(Eppendorf). Plates were stored at 4 °C prior to LCMS analysis.
-
Phosphoproteomics of cellular mechanosensing reveals NFATC4 as a regulator of myofibroblast activitybioRxiv - Systems Biology 2023Quote: ... Bound phosphopeptides were eluted 2 times with 30 μl elution buffer (40 % ACN, 15 % NH4OH (25 %, HPLC grade)) each and collected by centrifugation into clean PCR tubes (Eppendorf). Samples were concentrated in a SpeedVac for 15 min ...
-
bioRxiv - Cell Biology 2024Quote: ... then diluted in 2 mL of warm DMEM F12 in a 15 mL Eppendorf conical tube (Eppendorf, Catalog No. 0030122151). Our protocol was adapted from previous reports 34 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 120 uL of resuspended EVs samples were incubated with 15 uL EVs capture beads overnight at room temperature in Thermomixer orbital shaker (Eppendorf). EVs and bead mixture was then washed with 500 uL MACSPlex buffer and centrifuged at 3000xg for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2024Quote: ... The coverslip was subjected to centrifugation in the 6-well plate at 500 x g for 15 min using a plate centrifuge (Eppendorf). Following this ...
-
bioRxiv - Cell Biology 2024Quote: ... and the remainder of the bacteria were harvested by 15 min centrifugation at 2683 ×g in a swing-out centrifuge (5810 R, Eppendorf). Supernatant was removed and 200 µL of lysis buffer (2% Deoxycholic acid in 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Cell Biology 2024Quote: ... and the remainder of the bacteria were harvested by 15 min centrifugation at 2683 ×g in a swing-out centrifuge (5810 R, Eppendorf). Supernatant was removed and 200 µL of lysis buffer (2% Deoxycholic acid in 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Genomics 2021Quote: ... and held at 4 C° using the Mastercycler Nexus (Eppendorf, Australia). This was then cycled a total of 40 times ...
-
bioRxiv - Molecular Biology 2023Quote: ... Melting curves were obtained on a qPCR machine (Eppendorf RealPlex 4), ramping up from 25 to 95 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... and 10,000 × g at 4 °C for 30 min (Eppendorf 5910R). Pre-cleared supernatants were subjected to ultracentrifugation at 29,000 rpm using a Beckman SW40 Ti rotor (RCFavg ...
-
bioRxiv - Cancer Biology 2024Quote: ... or a realplex 4 qPCR 96-Well Real Time Cycler (Eppendorf) with 5% of the immunoprecipitated DNA used in a 20 ul PCR reaction ...
-
bioRxiv - Cancer Biology 2024Quote: ... in a Realplex 4 qPCR 96-Well Real Time Cycler (Eppendorf). Ct values were internally normalized to GAPDH for each sample ...
-
bioRxiv - Microbiology 2024Quote: ... veronii cultures were centrifuged for 4 min at 12,000 rpm (Eppendorf centrifuge 5810R with an F-34-6-38 rotor ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting supernatant was centrifuged (Eppendorf 5810R, A-4-62 Rotor) for 10 minutes at 500 x g to separate the cells from plasma ...
-
bioRxiv - Immunology 2022Quote: ... 10 g NaCl) grown in 2 L baffled shake flasks or a 10 L BioFlo 320 Fermenter (Eppendorf). Cells were grown at 37°C to an OD600 ∼ 0.8 ...
-
bioRxiv - Immunology 2020Quote: ... 10 g NaCl) grown in 2 L baffled shake flasks or a 10 L BioFlo 320 Fermenter (Eppendorf). Cells were grown at 37°C to an OD600 ~0.8 ...
-
bioRxiv - Genomics 2020Quote: ... 20-100% of the 1 mL lysate is purified (96 well vs Eppendorf tubes). 96 well format is eluting in 25ul and utilizing 8.6ul in qPCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were vigorously shaken for 20 min at 16°C in a thermomixer (Eppendorf), sonicated for 10 cycles at 4°C with 30 sec on and 30 sec off ...
-
bioRxiv - Pathology 2024Quote: ... 20 mg of pooled sample was placed into 2 mL tubes (Eppendorf, Hamburg, Germany) and 600 µL chloroform/methanol (2:1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
bioRxiv - Cell Biology 2023Quote: ... in a 5% CO2 containing humidified incubator (Eppendorf Galaxy 170S) at 37°C.
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Immunology 2024Quote: ... samples were microcentrifuged at 12,000g for 5 min (Eppendorf 5415C), supernatant aspirated and discarded ...
-
bioRxiv - Microbiology 2024Quote: ... kidneys and spleens were homogenized in 5 mL tubes (Eppendorf) containing 500uL of 3.2mm stainless steel beads (Next Advance ...
-
bioRxiv - Microbiology 2024Quote: ... and harvested by centrifugation (Eppendorf 5417, 20,817 g, 5 min). The cell pellet was then resuspended with equal volumes (1 ml ...
-
bioRxiv - Biophysics 2024Quote: ... 50 mM NaCl in 5 ml Protein LoBind tubes (Eppendorf). For refolding ...
-
bioRxiv - Biophysics 2024Quote: ... at 90°C for 5 minutes (Thermomixer C, Eppendorf, MA). The samples were loaded onto a 4-20% Mini-PROTEAN precast protein gel (Bio-Rad ...
-
bioRxiv - Bioengineering 2024Quote: 1x 10 µL micro-pipette (3123000020, Eppendorf)
-
bioRxiv - Bioengineering 2023Quote: ... Fluorescence measurements were taken at day 1 (when the PCL-TMA/PCL-TMA900 scaffolds were removed from the Eppendorf tube after 24 hours of cell seeding) and on day 14 (each scaffold was moved to a new 24 well plate to ensure only adherent cells were quantified) ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were quickly washed in cold PBS and AlphaScreen™ lysis buffer was added for 15 min under middle shaking (600 rpm on orbital rocker, MixMate, Eppendorf). Immediately ...