Labshake search
Citations for Eppendorf :
401 - 450 of 749 citations for 6 fluoro 1 4 fluorophenyl 7 4 methylpiperazin 1 yl 4 oxoquinoline 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... 1 ml aliquots were concentrated in a speed-vac (Eppendorf) for 45 min at 30°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... was injected at a concentration of 40 mM in embryos either at the end of cellularization around 5 min before imaging or at stage 7 during imaging using an InjectMan4 micromanipulator and a FemtoJet 4i microinjector from Eppendorf directly installed on the imaging microscope.
-
bioRxiv - Cell Biology 2020Quote: ... or western blot analysis (200 000 cells in 6-well plates (Eppendorf, cat# 0030720113) were left to attach for 48h ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then seeded in a Matrigel-coated 6-well plate (Eppendorf, cat # 0030720113) to 2.5×106 cells/well with dual SMAD inhibitor media supplemented with Dorsomorphin (1μM ...
-
bioRxiv - Physiology 2020Quote: ... 1% Antibiotic-Antimycotic] in a 5% CO2 incubator (Galaxy 170R, Eppendorf) at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... bacterial cultures (1 mL) were separately transferred to sterile cuvettes (Eppendorf), and the optical density (OD600 ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by centrifugation (1000 rpm, 1 minute, Eppendorf 5804R, Hamburg, Germany) and subsequently the plates were incubated for 30 minutes at room temperature (RT) ...
-
bioRxiv - Molecular Biology 2022Quote: ... at 211 g for 1 hour at room temperature (Eppendorf ThermoMixerC). Eluate was then removed ...
-
bioRxiv - Molecular Biology 2021Quote: ... and spun down at 2,000 rcf for 1 minute (Eppendorf 5810R) before stored at −80 °C.
-
bioRxiv - Synthetic Biology 2020Quote: Batch fermentations were conducted in 1 L DASGIP bioreactors (Eppendorf, Germany) with an initial volume of 550 mL ...
-
bioRxiv - Cell Biology 2022Quote: ... Aliquoted extracts were dried in vacuo (Eppendorf concentrator 5301, 1 ppm) and redissolved in 2-propanol (15 ul ...
-
bioRxiv - Biochemistry 2023Quote: ... Aliquoted extracts were dried in vacuo (Eppendorf concentrator 5301, 1 ppm) and redissolved in 2propanol (15μl ...
-
bioRxiv - Molecular Biology 2024Quote: ... then transferred to a 1-mL DNA LoBind tube (Eppendorf, 022431021). Cells were resuspended to 1 mL PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Bioengineering 2019Quote: ... centrifuging for 5 min at 400 rcf (RT, Eppendorf 5430; Rotor: F-35-6-30), re-suspension in fresh medium and transfer to cultivation flask.
-
bioRxiv - Biochemistry 2021Quote: ... cells were seeded into 6-well or 12-well polystyrene coated plates (Eppendorf; EP0030720130, EP0030721012) at a density of 0.3 x 106 cells mL−1 or 0.1 x 106 cells mL−1 ...
-
bioRxiv - Cell Biology 2022Quote: ... Eluted lysates in 60% acetonitrile/0.1% formic acid were dried by vacuum centrifugation (Eppendorf; Concentrator Plus) at 45°C.
-
bioRxiv - Biochemistry 2023Quote: ... in 0.3% acetic acid was added to a 96-well plate (CAT# 0030128664, Eppendorf, Hamburg, Germany), sealed with plate seal (CAT# 5010-21951 ...
-
bioRxiv - Biochemistry 2019Quote: ... toluol and BCP for 1 min (21 °C, 2000 r.p.m, Eppendorf ThermoMixer) and centrifuged 20.000 ×g for 3 min ...
-
bioRxiv - Biochemistry 2021Quote: ... and the solvent was removed in vacuo (Eppendorf concentrator 5301, 1 mbar). A Quality Control (QC ...
-
bioRxiv - Neuroscience 2021Quote: ... Plates were centrifuged at 1000xG for 1 minute (Eppendorf 5804R, Hamburg, Germany) and incubated for 30 min at room temperature (RT ...
-
bioRxiv - Genetics 2019Quote: ... and co-injected into 1-cell stage embryos using a microinjector (Eppendorf). Amplification of the target regions for genotyping was performed using primer pairs 5’-AGACGCTCCTCAACTCCAGA-3’ and 5’- GCCGTGTAGACGAGTGTGTT-3’ for exon 20/21 in togaram1 ...
-
bioRxiv - Bioengineering 2022Quote: ... Aliquots of 1 mL were centrifuged in a table-top centrifuge (Eppendorf 5424 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Fractions of 1 mL were dried in a SpeedVac Concentrator Plus (Eppendorf), then reconstituted in 1 mL of 0.1 % trifluoroacetic acid and desalted using an Agilent Macroporous Reversed-Phase C18 column (4.6 × 50 mm mRP-C18 ...
-
bioRxiv - Microbiology 2023Quote: ... cell samples were diluted in 1-ml 96-well plates (Eppendorf, Germany) and stained with 3 μl of the SG/PI staining solution ...
-
bioRxiv - Bioengineering 2023Quote: ... 1×106 cells were transferred into 1.5 mL microcentrifuge tubes (Eppendorf, Germany) and washed twice with ice cold FACS buffer containing 5% FBS in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... Resuspended lipid extracts were diluted 1:10 in 96-well plates (Eppendorf twin tec 96 ...
-
bioRxiv - Biophysics 2023Quote: ... was dried under nitrogen followed by 1 hour in vacuum (Rotovap;Eppendorf), then rehydrated overnight using PBS (pH = 7.4) ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were kept soaked at 37 °C for up to 7 days on an orbital shaker (Excella E24, Eppendorf, Hamburg, Germany) with an agitation rate of 150 rpm ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfected cells were transferred into 8.0 mL of MA2 media in 20 mL culture tubes and allowed to recover while rotating (∼80 rpm) in the outer rim of a tissue culture roller drum (New Brunswick; model TC-7; Eppendorf, USA) housed in an Algatron® incubator (Photon Systems Instruments ...
-
bioRxiv - Biophysics 2023Quote: ... The blood was centrifuged at 250 RCF (relative centrifugal force) and 7 rad/s2 acceleration for 20 min (5810 R, Eppendorf, Hamburg, Germany). The platelet rich plasma (PRP ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and then 6 mL of the culture was collected by centrifugation at 2,500g (5810 R, Eppendorf) for 5 min at room temperature.
-
bioRxiv - Biophysics 2021Quote: ... and incubated for 1 hour at 37 °C (incubator Thermomixer C, Eppendorf, Germany). Control samples (no AMPs ...
-
bioRxiv - Biochemistry 2019Quote: ... pH 8.0) during 1 h at 37 °C and 1000 rpm (ThermoMixer, Eppendorf), as described in [12] ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... transferred 1 ml serum to 1.5 ml Eppendorf Tubes® (Eppendorf AG, Hamburg) and stored them at −32° C until assaying ...
-
bioRxiv - Molecular Biology 2022Quote: ... and then incubated for 1 hour with agitation at orbital shaker (Eppendorf, USA) at 55 °C ...
-
bioRxiv - Biophysics 2021Quote: ... diluted 1:10 in 96-well plates (Eppendorf twin.tec® 96; Sigma-Aldrich). Cholesterol measurements were performed in positive ion mode ...
-
bioRxiv - Immunology 2019Quote: ... and (1×106) incubated at 37°C in centrifuge microtubes (Eppendorf, NY, USA) with or without a M ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1% bromophenol blue) and incubated at 40 °C in a Thermomixer R (Eppendorf) for 0.5 h ...
-
bioRxiv - Immunology 2020Quote: ... a BioSan Vortex V-1 plus and a Table centrifuge (Eppendorf Centrifuge 5424) were also used during the coupling process.
-
bioRxiv - Microbiology 2022Quote: ... incubated (1 h) and centrifuged (Eppendorf centrifuge R5810, 4000 rpm for 5 min) for β-galactosidase activity quantification ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 ml of bacterial culture was then transferred to sterile cuvettes (Eppendorf). The optical density (OD600 ...
-
bioRxiv - Neuroscience 2023Quote: ... for 1 hour under shaking at 400 rpm using a ThermoMixer C (Eppendorf). Luminescent was read at the Cytation5M reader (BioTek) ...
-
bioRxiv - Genomics 2024Quote: ... 1 mL of well-grown culture was centrifuged (5 min, 2040 g; Eppendorf) and the superfluous medium was removed by pipetting ...
-
bioRxiv - Cancer Biology 2024Quote: ... at a 1:50 ratio in a ThermoMixer C (Eppendorf, Nijmegen, The Netherlands) at 2,000 rpm for 18 hours at 37°C.
-
bioRxiv - Cancer Biology 2024Quote: ... centrifuging the bacteria at 12,000 x G for 1 min (Eppendorf 5430 centrifuge), and resuspended in cold sterile PBS to the desired concentration (either 107 PFU/ 50 μl or 106 PFU/50 μl) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... a 6 mL portion of each cell culture was collected by centrifugation at 2,500g (5810 R, Eppendorf) for 5 min at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: For esiRNA transfection 35,000 U2OS cells were seeded in 2 ml medium in 6-well plates (Eppendorf) the evening before transfection ...
-
bioRxiv - Genomics 2020Quote: ... 20-100% of the 1 mL lysate is purified (96 well vs Eppendorf tubes). 96 well format is eluting in 25ul and utilizing 8.6ul in qPCR ...
-
bioRxiv - Microbiology 2022Quote: ... soil samples for DNA isolation were aliquoted (~1 g into 1.5 ml Eppendorf tubes) and stored immediately at −20 °C ...