Labshake search
Citations for Eppendorf :
401 - 450 of 1035 citations for 6 Bromo 3 4 dihydro 4 phenyl 2H 1 benzopyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Later they were put in 2ml Eppendorf in 70% ethanol (60 flies in one Eppendorf). Flies were first crushed in 150ul of 70% ethanol and then 150ul 70% ethanol was added to crush them more ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Microinjection was carried out in medaka embryos at the one-cell stage using FemtoJet (Eppendorf) and InjectMan NI 2 (Eppendorf) ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL droplets were inoculated into 6-well plates (Eppendorf, Hamburg, Germany). After allowing the cells to adhere to the surface for 2 hours in a CO2 incubator (37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... for 6 h at 37 °C at 800 rpm (shaking incubator, Eppendorf). After RNAse A was removed by centrifugation ...
-
bioRxiv - Plant Biology 2024Quote: ... SDS at a 1:3 (w/v) ratio and extracted by shaking 1000 RPM 95 °C for using a tabletop shaker (Eppendorf ThermoMixer F2.0). Samples were then centrifuged at 20,000 xg for 10 min at room temperature and the supernatant retained in new tubes ...
-
bioRxiv - Neuroscience 2023Quote: ... 100 microglia were sorted and immediately collected in one well of a 96-well plate (Eppendorf) filled with 5 µl cold lysis buffer from the NEBNext® Single Cell/Low Input cDNA Synthesis & Amplification Module (New England Bio Labs ...
-
bioRxiv - Cell Biology 2023Quote: ... The isolated flagella were pelleted one final time at ∼20000xg (14000rpm in an Eppendorf 5417C centrifuge) for 20 min at 4 C ...
-
bioRxiv - Neuroscience 2022Quote: ... 1-2 fecal pellets were collected from each mouse by voluntary defecation into a sterile microtube (Eppendorf, Germany) and fecal samples were immediately placed on dry ice ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... pH 7.6) and injected into 1 to 2-cell-stage embryos by using a microinjector FemtoJet 5247 (Eppendorf). The sequences and the concentrations of MOs (Gene Tools ...
-
bioRxiv - Developmental Biology 2023Quote: ... Organoids were transferred to a 6 cm ultra-low-attachment dish (Eppendorf, 30701011) containing Tyrode’s solution (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... were injected into one of the paired olfactory cavities through fine glass capillaries using a pressurized (Eppendorf FemtoJet Express ...
-
bioRxiv - Molecular Biology 2022Quote: One ml of SF per sample was spun in a benchtop centrifuge (Eppendorf non-refrigerated centrifuge 5420) at rpm1400rpm for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... or western blot analysis (200 000 cells in 6-well plates (Eppendorf, cat# 0030720113) were left to attach for 48h ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then seeded in a Matrigel-coated 6-well plate (Eppendorf, cat # 0030720113) to 2.5×106 cells/well with dual SMAD inhibitor media supplemented with Dorsomorphin (1μM ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and InjectMan NI 2 (Eppendorf). Cas9 protein (500 ng/μL) ...
-
bioRxiv - Developmental Biology 2019Quote: ... We have determined that one critical parameter in this process is the use of low-retention 1.5 ml microcentrifuge tubes (e.g., Eppendorf DNA LoBind tubes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The mixture was incubated at 25 °C and 1,500 rpm for one hour by using a ThermoMixer (Eppendorf), and then centrifuged at 14,000 rpm for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... For that 2.5x105 cells were incubated with HIV-1 antigens in PBS/2% FCS for the indicated period of times on a 37°C thermomixer (Eppendorf). Cells were then fixed with IC fixation buffer on ice for 30 mins and at RT for additional 30 mins ...
-
bioRxiv - Molecular Biology 2022Quote: ... Destained gel bands were first cut into small cubes (1-2 mm in each dimension) using a clean scalpel and transferred to new LoBind tubes (Eppendorf). Gel cubes were dehydrated by incubating in 500 μL acetonitrile (ACN ...
-
bioRxiv - Genetics 2022Quote: ... Fractions were collected every three minutes, and fractions were pooled in two passes (1 + 17, 2 + 18 … etc.) and dried in a Speed-Vac (Eppendorf).
-
bioRxiv - Microbiology 2023Quote: ... the mucin beads sampled from different time points were first washed with 1 ml filter-sterilized PBS in 2-ml tubes (Eppendorf). After carefully removing the supernatant ...
-
bioRxiv - Plant Biology 2023Quote: ... benthamiana leaf tissue 5-days post Agrobacterium infiltration was collected using a leaf disc cutter 1 cm in diameter and placed inside a 2 mL safe-lock tube (Eppendorf). Each biological replicate consisted of 4 leaf discs from the same leaf (approximately 40 mg fresh weight) ...
-
bioRxiv - Cell Biology 2022Quote: ... Fractions were collected every three minutes, pooled in two passes (fraction 1 + 17, fraction 2 + 18,…, etc.) and dried in a vacuum centrifuge (Eppendorf).
-
bioRxiv - Cell Biology 2022Quote: ... Fractions were collected every three minutes, and fractions were pooled in two passed (1 + 17, 2 + 18 … etc.) and dried in a vacuum centrifuge (Eppendorf). Dried fractions were resuspended in 0.1% formic acid and analyzed on a Orbitrap Lumos Tribrid mass spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Fractions were collected every three minutes, and fractions were pooled in two passes (1 + 17, 2 + 18 … etc.) and dried in a vacuum centrifuge (Eppendorf). Dried fractions were re-suspended in 0.1% formic acid (FA ...
-
bioRxiv - Developmental Biology 2024Quote: ... One nL morpholino (dissolved in 0.2 M KCl with 0.05% phenol red at 3 mg/mL) was microinjected into haploid embryos at the 1 or 2-cell stage using FemtoJet and InjectMan NI2 (Eppendorf).
-
bioRxiv - Microbiology 2023Quote: Overnight cultures of the investigated strains were prepared in 1 mL aliquots of TSB in 2 mL microcentrifuge tubes (Eppendorf) which were incubated horizontally with shaking (120 rpm ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Genomics 2019Quote: ... One µl of this cocktail was added to the PCR mixture and placed in a thermocycler (Eppendorf MasterCycler Pro). Thermocycling settings were as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... One milliliter of the supernatant was then transferred to new tubes after centrifugation at 14,000 rpm (Eppendorf K-5418R). A total of 1.2 mL of a 10 mM sodium periodate solution (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... Injections were performed in less than one-day-old female pupae using a microinjector (Fentojet® Express, Eppendorf®) and a micromanipulator (Narishige®) ...
-
bioRxiv - Bioengineering 2019Quote: ... centrifuging for 5 min at 400 rcf (RT, Eppendorf 5430; Rotor: F-35-6-30), re-suspension in fresh medium and transfer to cultivation flask.
-
bioRxiv - Biochemistry 2021Quote: ... cells were seeded into 6-well or 12-well polystyrene coated plates (Eppendorf; EP0030720130, EP0030721012) at a density of 0.3 x 106 cells mL−1 or 0.1 x 106 cells mL−1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... using a Realplex 2 thermocycler (Eppendorf). The PCR conditions were 95°C for 3 min ...
-
bioRxiv - Immunology 2022Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was mounted on an Andor Spinning Disc Microscope and microinjection was performed using the microinjector FemtoJet with a 100X oil immersion objective to facilitate immediate visualization and image acquisition after microinjection ...
-
bioRxiv - Cell Biology 2023Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was positioned and microinjection was performed using microinjector (Eppendorf FemtoJet ...
-
bioRxiv - Cancer Biology 2024Quote: ... on a RealPlex 2 Thermocycler (Eppendorf).
-
bioRxiv - Microbiology 2024Quote: ... and Mastercycler ep Realplex 2 (Eppendorf). Data was normalized by GAPDH or sigA expression level and all primers were designed using GenScript primer design software ...
-
bioRxiv - Cell Biology 2021Quote: ... Frozen cell pellets were resuspended in hypotonic buffer and homogenized using a disposable plastic pestle (As One Corp., Osaka, Japan) with matched Safe-Lock tubes (Eppendorf). The detailed procedure is summarized in Fig ...
-
bioRxiv - Genomics 2021Quote: ... live cell was index-sorted into one 96-well quadrant of a 384-well plate (Eppendorf lo-bind twin-tec) containing a mixture of DPBS and shearing master mix at a final volume of 2.14 μL using a MoFlo Astrios cell sorter running Summit v6.3 (Beckman Coulter) ...
-
bioRxiv - Bioengineering 2019Quote: ... One hundred nanograms of cDNA were amplified in duplicates in each 40-cycle reaction using a Mastercycler (Eppendorf, Hauppauge, NY) with annealing temperature set at 60°C ...
-
bioRxiv - Genetics 2021Quote: ... Oxford Nanopore Technologies, SQK-LSK109. At this step, the resuspendend beads from the three samples were pooled into one Eppendorf tube ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 nl of the mix was injected into the cell of a one-cell stage embryo using a FemtoJet Microinjector (Eppendorf).
-
bioRxiv - Genomics 2023Quote: ... Single mantamonad cells were then isolated from one of the enriched cultures with an Eppendorf PatchManNP2 micromanipulator using a 65 µm VacuTip microcapillary (Eppendorf) and a Leica Dlll3000 B inverted microscope ...
-
bioRxiv - Genetics 2023Quote: Zebrafish embryos were collected and injected as previously described (Rosen et al., 2009) at one-cell stage using a FemtoJet Injector (Eppendorf) or PV820 injector (WPI ...
-
bioRxiv - Microbiology 2024Quote: ... A volume of 1 nL containing 500 ng/μL mRNA coding for each of these proteins was injected into one-cell stage embryos using the FemtoJet 4i microinjector (Eppendorf). H2O was used as reference control.
-
bioRxiv - Microbiology 2021Quote: ... Bacillus cereus group isolates’ inocula were prepared from overnight cultures (see “Bacterial cultures” section) by adjusting their concentration to 1-2 × 108 CFU/ml using a spectrophotometer (Eppendorf BioPhotometer 6131). A previously established OD-CFU standard curve was used to estimate the CFU/ml based on the OD reading ...
-
bioRxiv - Biochemistry 2022Quote: ... samples were prepared in 96 well microtiter plates by adding 12.5 μL reaction supernatant to 50 μL acetonitrile with 1% v/v trifluoroacetic acid (TFA) followed by centrifugation (2,204 g, 30 min; A-2-DWP rotor, Eppendorf AG, Hamburg, Germany) and transferring of 50 μL centrifugation supernatant into 150 μL MilliQ H2O ...
-
bioRxiv - Neuroscience 2023Quote: ... The plasmid injection solution was injected into Hydra vulgaris AEP 1-cell stage embryos using an Eppendorf FemtoJet 4x and Eppendorf InjectMan NI 2 microinjector (Eppendorf; Hamburg, Germany) under a Leica M165 C stereo microscope (Leica Microscopes ...
-
bioRxiv - Neuroscience 2023Quote: ... A total of 1800 µl of solution from both tubes (batch 1) were transferred to a 2 ml Eppendorf and vortexed (Eppendorf Thermomixer C) for 15 minutes at 2000 rpm (4 °C) ...