Labshake search
Citations for Eppendorf :
401 - 450 of 1029 citations for 6 1 4 dioxa 8 azaspiro 4.5 decan 8 yl 3 hydroxy 2 iminopyrimidin 4 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 12,000 rpm was applied for 30 minutes at 4 °C to obtain the supernatant and then evaporated to obtain a dry metabolite pellet (Eppendorf Concentrator plus, Hamburg, Germany). For the NMR experiments ...
-
bioRxiv - Cell Biology 2019Quote: ... HeLa SS6 or 1.E cells were seeded into 35 mm tissue culture dishes or 6 well tissue culture plates (Eppendorf) with or without pre-cleaned ...
-
bioRxiv - Immunology 2022Quote: ... Cells were washed with 500μl of D-PBS and centrifuged at 400xg for 10 minutes at room temperature (Eppendorf Centrifuge 5810R, rotor A-4-62). The supernatant was removed and the cell pellet resuspended in 50μl of D-PBS before being stained with CD20-PE (clone A1SB12 ...
-
bioRxiv - Neuroscience 2021Quote: ... were incubated with ten-fold molar excess S-XL6 for 4 hours at 37 °C in protein low bind Eppendorf tubes using Eppendorf Thermomixer at 350 rpm (Eppendorf North America, Enfield, CT, USA). After incubation ...
-
bioRxiv - Bioengineering 2023Quote: ... MPCs were washed twice for 3 min at 400 RCF at room temperature with PBS supplemented with 1% glucose and 1% pen-strep (Eppendorf 5702R, Hamburg, Germany). Biotinylation of the cell surface was performed by adding 1 mM Sulfo-NHS-LC-Biotin (Thermo Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Biochemistry 2020Quote: Microdissected tissue samples were lysed in SDT buffer (4% SDS, 0.1M DTT, 0.1M Tris/HCl, pH 7.6) in a thermomixer (Eppendorf ThermoMixer® C, 30 min, 95°C, 750 rpm). After that ...
-
bioRxiv - Microbiology 2022Quote: ... Trophozoites were harvested from their growth support by incubating the tubes by tapping the glass tubes followed by centrifugation (Eppendorf centrifuge 5810R, rotor A-4-62) according to a previously reported protocol 84.
-
bioRxiv - Molecular Biology 2023Quote: ... The mixture was sonicated 3 times for 1 minute in a waterbath sonicator and incubated in a ThermoMixer (Eppendorf) for 30 minutes at 37°C and 500 rpm ...
-
bioRxiv - Bioengineering 2020Quote: The cjFFs were transfected at P4-6 with Multiporator (Eppendorf) according to the protocol provided by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: ... with an fixed angled-rotor (FA-45-6-30, Eppendorf) and the virus pellet was resuspended in OPC-Sato medium for 1 hour at 4°C on a shaker ...
-
bioRxiv - Microbiology 2022Quote: ... 1 ml of the lung homogenate was added to 2 ml DNA LoBind tubes (Eppendorf) alongside 500 µl sterile killing buffer (20 mM Tris-HCl pH 7.5 ...
-
The conserved membrane-proximal domain of Sbh1/ Sec61β guides signal peptides into the Sec61 channelbioRxiv - Biochemistry 2024Quote: ... Cells (2 OD600) were harvested at 600 x g for 1 min (MiniSpin Centrifuge, Eppendorf) and the supernatants were discarded ...
-
bioRxiv - Biophysics 2022Quote: ... the DNA droplet-containing aqueous phase was layered on top of the oil phase in a volumetric ratio of 1:3 within a microtube (Eppendorf). For the segregation of DNA droplets using enzymatic activity ...
-
bioRxiv - Biophysics 2022Quote: ... The aqueous solution was layered on top of the oil-surfactant mix in a volumetric ratio of 1:3 inside a microtube (Eppendorf). The tube was manually shaken for about 30 s until water-in-oil droplets formed ...
-
bioRxiv - Biophysics 2020Quote: ... the DNA-containing aqueous phase was layered on top of the oil phase in a volumetric ratio of 1:3 within a microtube (Eppendorf). Droplet formation was induced by manual shaking for about 4 s as described earlier.[26] For the oil-phase ...
-
bioRxiv - Genomics 2024Quote: ... and washed in nuclease-free H2O before proceeding to MNase digestion with 1-2U of MNase for 3×106 cells that went on for 1-hour at 37C while shaking in a thermomixer (Eppendorf) at 550rcf ...
-
bioRxiv - Microbiology 2020Quote: ... nine 1 mL aliquots were centrifuged for 2 min at 2500 rcf (Eppendorf, Centrifuge 5424 R) and the MOPS-based supernatant removed ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL droplets were inoculated into 6-well plates (Eppendorf, Hamburg, Germany). After allowing the cells to adhere to the surface for 2 hours in a CO2 incubator (37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... for 6 h at 37 °C at 800 rpm (shaking incubator, Eppendorf). After RNAse A was removed by centrifugation ...
-
bioRxiv - Plant Biology 2024Quote: ... SDS at a 1:3 (w/v) ratio and extracted by shaking 1000 RPM 95 °C for using a tabletop shaker (Eppendorf ThermoMixer F2.0). Samples were then centrifuged at 20,000 xg for 10 min at room temperature and the supernatant retained in new tubes ...
-
bioRxiv - Neuroscience 2022Quote: ... 1-2 fecal pellets were collected from each mouse by voluntary defecation into a sterile microtube (Eppendorf, Germany) and fecal samples were immediately placed on dry ice ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... pH 7.6) and injected into 1 to 2-cell-stage embryos by using a microinjector FemtoJet 5247 (Eppendorf). The sequences and the concentrations of MOs (Gene Tools ...
-
bioRxiv - Developmental Biology 2023Quote: ... Organoids were transferred to a 6 cm ultra-low-attachment dish (Eppendorf, 30701011) containing Tyrode’s solution (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... or western blot analysis (200 000 cells in 6-well plates (Eppendorf, cat# 0030720113) were left to attach for 48h ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then seeded in a Matrigel-coated 6-well plate (Eppendorf, cat # 0030720113) to 2.5×106 cells/well with dual SMAD inhibitor media supplemented with Dorsomorphin (1μM ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and InjectMan NI 2 (Eppendorf). Cas9 protein (500 ng/μL) ...
-
bioRxiv - Immunology 2022Quote: ... For that 2.5x105 cells were incubated with HIV-1 antigens in PBS/2% FCS for the indicated period of times on a 37°C thermomixer (Eppendorf). Cells were then fixed with IC fixation buffer on ice for 30 mins and at RT for additional 30 mins ...
-
bioRxiv - Molecular Biology 2022Quote: ... Destained gel bands were first cut into small cubes (1-2 mm in each dimension) using a clean scalpel and transferred to new LoBind tubes (Eppendorf). Gel cubes were dehydrated by incubating in 500 μL acetonitrile (ACN ...
-
bioRxiv - Genetics 2022Quote: ... Fractions were collected every three minutes, and fractions were pooled in two passes (1 + 17, 2 + 18 … etc.) and dried in a Speed-Vac (Eppendorf).
-
bioRxiv - Microbiology 2023Quote: ... the mucin beads sampled from different time points were first washed with 1 ml filter-sterilized PBS in 2-ml tubes (Eppendorf). After carefully removing the supernatant ...
-
bioRxiv - Plant Biology 2023Quote: ... benthamiana leaf tissue 5-days post Agrobacterium infiltration was collected using a leaf disc cutter 1 cm in diameter and placed inside a 2 mL safe-lock tube (Eppendorf). Each biological replicate consisted of 4 leaf discs from the same leaf (approximately 40 mg fresh weight) ...
-
bioRxiv - Cell Biology 2022Quote: ... Fractions were collected every three minutes, pooled in two passes (fraction 1 + 17, fraction 2 + 18,…, etc.) and dried in a vacuum centrifuge (Eppendorf).
-
bioRxiv - Cell Biology 2022Quote: ... Fractions were collected every three minutes, and fractions were pooled in two passed (1 + 17, 2 + 18 … etc.) and dried in a vacuum centrifuge (Eppendorf). Dried fractions were resuspended in 0.1% formic acid and analyzed on a Orbitrap Lumos Tribrid mass spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Fractions were collected every three minutes, and fractions were pooled in two passes (1 + 17, 2 + 18 … etc.) and dried in a vacuum centrifuge (Eppendorf). Dried fractions were re-suspended in 0.1% formic acid (FA ...
-
bioRxiv - Developmental Biology 2024Quote: ... One nL morpholino (dissolved in 0.2 M KCl with 0.05% phenol red at 3 mg/mL) was microinjected into haploid embryos at the 1 or 2-cell stage using FemtoJet and InjectMan NI2 (Eppendorf).
-
bioRxiv - Microbiology 2023Quote: Overnight cultures of the investigated strains were prepared in 1 mL aliquots of TSB in 2 mL microcentrifuge tubes (Eppendorf) which were incubated horizontally with shaking (120 rpm ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Bioengineering 2019Quote: ... centrifuging for 5 min at 400 rcf (RT, Eppendorf 5430; Rotor: F-35-6-30), re-suspension in fresh medium and transfer to cultivation flask.
-
bioRxiv - Biochemistry 2021Quote: ... cells were seeded into 6-well or 12-well polystyrene coated plates (Eppendorf; EP0030720130, EP0030721012) at a density of 0.3 x 106 cells mL−1 or 0.1 x 106 cells mL−1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... using a Realplex 2 thermocycler (Eppendorf). The PCR conditions were 95°C for 3 min ...
-
bioRxiv - Immunology 2022Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was mounted on an Andor Spinning Disc Microscope and microinjection was performed using the microinjector FemtoJet with a 100X oil immersion objective to facilitate immediate visualization and image acquisition after microinjection ...
-
bioRxiv - Cell Biology 2023Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was positioned and microinjection was performed using microinjector (Eppendorf FemtoJet ...
-
bioRxiv - Cancer Biology 2024Quote: ... on a RealPlex 2 Thermocycler (Eppendorf).
-
bioRxiv - Microbiology 2024Quote: ... and Mastercycler ep Realplex 2 (Eppendorf). Data was normalized by GAPDH or sigA expression level and all primers were designed using GenScript primer design software ...
-
bioRxiv - Microbiology 2021Quote: ... Bacillus cereus group isolates’ inocula were prepared from overnight cultures (see “Bacterial cultures” section) by adjusting their concentration to 1-2 × 108 CFU/ml using a spectrophotometer (Eppendorf BioPhotometer 6131). A previously established OD-CFU standard curve was used to estimate the CFU/ml based on the OD reading ...
-
bioRxiv - Biochemistry 2022Quote: ... samples were prepared in 96 well microtiter plates by adding 12.5 μL reaction supernatant to 50 μL acetonitrile with 1% v/v trifluoroacetic acid (TFA) followed by centrifugation (2,204 g, 30 min; A-2-DWP rotor, Eppendorf AG, Hamburg, Germany) and transferring of 50 μL centrifugation supernatant into 150 μL MilliQ H2O ...
-
bioRxiv - Neuroscience 2023Quote: ... The plasmid injection solution was injected into Hydra vulgaris AEP 1-cell stage embryos using an Eppendorf FemtoJet 4x and Eppendorf InjectMan NI 2 microinjector (Eppendorf; Hamburg, Germany) under a Leica M165 C stereo microscope (Leica Microscopes ...
-
bioRxiv - Neuroscience 2023Quote: ... A total of 1800 µl of solution from both tubes (batch 1) were transferred to a 2 ml Eppendorf and vortexed (Eppendorf Thermomixer C) for 15 minutes at 2000 rpm (4 °C) ...