Labshake search
Citations for Eppendorf :
401 - 450 of 1217 citations for 1 5 Bis 2 2 methyl 1 oxoallyl oxy ethyl dihydrogen benzene 1 2 4 5 tetracarboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... A plasmid DNA solution of 1.4 µg/uL was injected into embryos using an Eppendorf FemtoJet 4x and Eppendorf InjectMan NI 2 microinjector (Eppendorf; Hamburg, Germany) under a Leica M165 C scope (Leica Microscopes ...
-
bioRxiv - Immunology 2022Quote: ... bacterial stocks were grown at 30°C for 2 days to an OD600 of 0.4 approximately 6.3×106CFU/mL (Eppendorf, BioPhotometer; Hamburg, Germany). Bacteria were washed with sterile PBS and aspirated through a 27G needle against the side of the tube multiple times to break up bacterial clumps ...
-
bioRxiv - Microbiology 2023Quote: ... 200 μl of the sample was mixed with an equal volume of buffered phenol and 20 μl of 20% SDS in a 2 mL centrifuge tube (Eppendorf, Germany). After adding 0.5g of 2 mm zirconia beads (BioSpec Inc. ...
-
bioRxiv - Genomics 2023Quote: ... The nuclei were diluted to ∼300 nuclei per uL across 2 x twin.tec™ 96 Well LoBind PCR Plates (Eppendorf, 0030129512). The reverse transcription reaction was set up as in Cao et al. ...
-
bioRxiv - Bioengineering 2024Quote: ... BMP-2 solution was added to FN coated polymers and after 2 h incubation solution was aspirated and collected in Protein LoBind Tubes (Eppendorf™). Enzyme-linked immunosorbent assays (ELISA ...
-
bioRxiv - Biochemistry 2024Quote: ... #33045-U) and incubated for 2 h at 60 °C at 400 rpm on a thermomixer (Eppendorf ThermoMixer C, Germany, #EP5382000023). Then ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Plant Biology 2023Quote: ... The extracted samples were aliquoted in 2 mL tubes and vaporized under vacuum at 40°C using SpeedVac (Eppendorf, Hamburg, Germany). The samples were resuspended and further diluted in sterile water before applying to MBA ...
-
bioRxiv - Biophysics 2023Quote: ... were coated with Expi293 cell produced RS2 at 4 µg/mL concentration in 1x PBS (60 µl/well) and incubated for 2 h at 25 °C under gentle shaking condition (300 rpm) on a thermomixer (Eppendorf, USA) and then plate was transferred to 4 °C cold room for overnight ...
-
bioRxiv - Bioengineering 2023Quote: ... Digested material was then eluted from the column by centrifuge at 1000 rpm for 2 minutes and dried in speedvac (Eppendorf, Germany). Each prepared sample was separated on Hi-pH column (Thermo ...
-
bioRxiv - Neuroscience 2024Quote: ... The homogenate was filtered through a 50 µm filter (Sysmex; 04-004-2327) into a 2 mL microcentrifuge tube (Eppendorf; 022431048). An additional 0.5 mL of homogenization buffer was used to wash the Dounce homogenizer and filter ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were then exposed to phages at indicated MOIs or incubated untreated for 30 min in a 2 mL Eppendorf tube under shaking conditions (<650 rpm in an Eppendorf ThermoMixer). For TIRF microscopy ...
-
bioRxiv - Biochemistry 2024Quote: Sieved soil and the extraction buffer consisting of 5% SDS in 25 mM Tris-HCL (pH 8.0) were combined in a 2 mL Eppendorf Lo-Bind tube (Eppendorf, Hamburg, Germany) and vortexed for 10 seconds to mix ...
-
bioRxiv - Bioengineering 2024Quote: ... The 12 initial cultivations were executed in a DASGIP© Parallel Bioreactor System (max. working volume 2 L; Eppendorf, Hamburg, Germany) as described in [51] ...
-
bioRxiv - Bioengineering 2020Quote: ... and microbubbles were isolated by 4 centrifugation wash cycles at 40 relative centrifugation force for 1 min (Eppendorf 5804, Hamburg, Germany), where the infranatant was discarded and the microbubble concentrate was saved and resuspended.
-
bioRxiv - Microbiology 2024Quote: ... The crude EV fractions were prepared by ultracentrifugation (45,000 rpm, 1 h, 4°C; S50A rotor, Himac Ultracentrifuge CS100GXII; Eppendorf Himac Technologies) of the thus prepared supernatants.
-
bioRxiv - Bioengineering 2023Quote: ... Cells were stained for 1 hour at a temperature of 4°C with shaking at 600 rpm in a Thermomixer comfort (Eppendorf, Germany). Stained cells were washed with ice cold FACS buffer twice before resuspension in FACS buffer for analysis ...
-
bioRxiv - Cell Biology 2024Quote: ... The protoplasts were collected by centrifugation at 1700 rpm for 1 minute using a swing-bucket rotor (Eppendorf S-4-72), washed with 15 mL of ice-cold solution 3 (26.4 g of ammonium sulfate ...
-
bioRxiv - Microbiology 2024Quote: ... An overnight culture of 1 ml was pelleted down by centrifugation ((10,000 rpm at 4°C for 10 min; Eppendorf centrifuge 5810R) and washed thrice with M9 minimal (M9M ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... The sequencing failed for 1 sample and 1 sample was damaged during the travel (Eppendorf tube burst), decreasing our total sample size to 41 ...
-
bioRxiv - Plant Biology 2024Quote: ... Duplicate samples of 1 mL were incubated for 1 h at 50 °C in a thermomixer (Eppendorf) with shaking at 600 rpm with 5 µL of CTec3 diluted 10-fold from the commercial product added to each sample ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
bioRxiv - Cell Biology 2023Quote: ... in a 5% CO2 containing humidified incubator (Eppendorf Galaxy 170S) at 37°C.
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Immunology 2024Quote: ... samples were microcentrifuged at 12,000g for 5 min (Eppendorf 5415C), supernatant aspirated and discarded ...
-
bioRxiv - Microbiology 2024Quote: ... kidneys and spleens were homogenized in 5 mL tubes (Eppendorf) containing 500uL of 3.2mm stainless steel beads (Next Advance ...
-
bioRxiv - Microbiology 2024Quote: ... and harvested by centrifugation (Eppendorf 5417, 20,817 g, 5 min). The cell pellet was then resuspended with equal volumes (1 ml ...
-
bioRxiv - Biophysics 2024Quote: ... 50 mM NaCl in 5 ml Protein LoBind tubes (Eppendorf). For refolding ...
-
bioRxiv - Biophysics 2024Quote: ... at 90°C for 5 minutes (Thermomixer C, Eppendorf, MA). The samples were loaded onto a 4-20% Mini-PROTEAN precast protein gel (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... The chondrocytes were incubated with the dye at 37°C for 2 hours at 300 rpm in a ThermoMixer C (Eppendorf, Hamburg, Germany). After incubation ...
-
bioRxiv - Cell Biology 2020Quote: ... the medium exchange was conducted under semi-sterile conditions directly at the microscope with a 10 μl microloader tip (Microloader Tip 0,5-10 μl / 2-20 μl, Eppendorf AG, Hamburg, Germany) every two days.
-
bioRxiv - Genetics 2022Quote: ... we inoculated yeast strains into 400 µL of liquid SC -lys medium with G418 for overnight growth in 2 mL 96 well plates at 30 °C with 1000 rpm mixing on a MixMate (Eppendorf, Hamburg, Germany). The next day ...
-
bioRxiv - Biophysics 2022Quote: ... Ltd., Kanagawa, Japan) controlled by a pneumatic microinjector (IM-11-2, Narishige, Tokyo, Japan) and a micromanipulator (Transferman NK2, Eppendorf, Hamburg, Germany) and transferred into 4 ml RNase-free water (06442-95 ...
-
bioRxiv - Microbiology 2021Quote: ... the plate was returned to the magnet and for 2 minutes and 48 μl of purified DNA was transferred to a fresh 96-well PCR plate (Eppendorf 0030 128.648).
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Neuroscience 2021Quote: ... a whole eye from wild type and mutant adult zebrafish or 100 zebrafish mutant larvae were transferred to 2 ml Eppendorf microcentrifuge tubes (Eppendorf, Hamburg, Germany). 200 μl of 2 M hydroxylamine (pH 8 ...
-
bioRxiv - Immunology 2022Quote: ... Purified IgG was digested into F(ab’)2 with 200 μg of IdeS per 10 mg of IgG for 6 hr on a thermal mixer (Eppendorf ThermoMixer C) at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... and Cas9 protein (100 ng/μl) were injected into individual eggs using a FemtoJet and InjectMan NI 2 microinjection system (Eppendorf, Hamburg, Germany). The microinjection process was completed within 2 hours ...
-
bioRxiv - Biochemistry 2024Quote: ... four times (1600 μL) ice-cold 80% acetone was added to 400 μL of urine in 2 ml protein Lo-Bind tubes (Eppendorf, Hamburg, Germany). After incubating at −20 °C for 1hr ...
-
bioRxiv - Genetics 2024Quote: ... and Cas9 protein (200 ng/μl) were injected into individual eggs using a FemtoJet and InjectMan NI 2 microinjection system (Eppendorf, Hamburg, Germany). The whole process was completed in two hours ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The ethyl acetate was then evaporated in a rotary evaporator (Concentrator plus, Eppendorf) at 60°C ...
-
bioRxiv - Immunology 2022Quote: ... 20 μL of mAb solution was added to the cells in the filter wells and the cells were incubated for 1 h at 4 °C and 750 RPM on a thermomixer (Eppendorf, ThermoMixer C). After the incubation ...
-
bioRxiv - Microbiology 2023Quote: Liquid samples in 1 ml were collected and centrifuged for 20 min at 21 130 × g at 4°C (Centrifuge 5424 R; Eppendorf, Hamburg, Germany). The supernatants were used for chemical analyses by applying external standards for calibration and quality control ...
-
bioRxiv - Bioengineering 2020Quote: ... Single colonies were grown overnight in 1 mL of SC or SC-ura medium supplemented with 2% glucose in individual wells of the 24-well microtiter plates under constant blue light in an orbital shaker (Eppendorf, New Brunswick, USA) at 30°C and at 200 rpm agitation ...
-
bioRxiv - Systems Biology 2021Quote: ... Cells were resuspended and 50 μl of each pre-culture was used to inoculate 1.5 mL of fresh YPD media (corresponding to an optical density of 0.5 at 600 nm) in 96-deep-well plates (LoBind®, 2 mL, cat no. 0030504305, Eppendorf AG, Hamburg, Germany). Plates were covered with an air permeable membrane and incubated while shaking at 300 rpm and 30 °C for 6 hours ...