Labshake search
Citations for Eppendorf :
401 - 450 of 910 citations for 1 2 Dihydro 1 2 tetrahydro 2H pyran 2 yl oxy ethyl 5H tetrazole 5 thione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: Using 5 mL lo-bind tubes (Eppendorf), 960 μL of ice-cold methanol was added to ~1 mL of protein supernatant and vortexed briefly before subsequent addition of 160 μL of ice-cold chloroform and thorough mixing ...
-
bioRxiv - Bioengineering 2022Quote: ... Subsequent washes were performed at a volume of 5 mL in 5 mL Eppendorf tubes (Cat. No. 0030122321, Eppendorf) and pelleted with a compatible microcentrifuge (MC-24™ Touch ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... were diluted with sterile 1x PBS to 10 µg/mL (according to the manufacturer’s recommendation) in the volume of 5 mL in 5-mL Protein LoBind tubes (Eppendorf). For chip assays ...
-
bioRxiv - Biochemistry 2021Quote: ... and the solvent was removed in vacuo (Eppendorf concentrator 5301, 1 mbar). A Quality Control (QC ...
-
bioRxiv - Neuroscience 2021Quote: ... Plates were centrifuged at 1000xG for 1 minute (Eppendorf 5804R, Hamburg, Germany) and incubated for 30 min at room temperature (RT ...
-
bioRxiv - Bioengineering 2022Quote: ... Aliquots of 1 mL were centrifuged in a table-top centrifuge (Eppendorf 5424 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Fractions of 1 mL were dried in a SpeedVac Concentrator Plus (Eppendorf), then reconstituted in 1 mL of 0.1 % trifluoroacetic acid and desalted using an Agilent Macroporous Reversed-Phase C18 column (4.6 × 50 mm mRP-C18 ...
-
bioRxiv - Microbiology 2023Quote: ... cell samples were diluted in 1-ml 96-well plates (Eppendorf, Germany) and stained with 3 μl of the SG/PI staining solution ...
-
bioRxiv - Bioengineering 2023Quote: ... 1×106 cells were transferred into 1.5 mL microcentrifuge tubes (Eppendorf, Germany) and washed twice with ice cold FACS buffer containing 5% FBS in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... Resuspended lipid extracts were diluted 1:10 in 96-well plates (Eppendorf twin tec 96 ...
-
bioRxiv - Biophysics 2023Quote: ... was dried under nitrogen followed by 1 hour in vacuum (Rotovap;Eppendorf), then rehydrated overnight using PBS (pH = 7.4) ...
-
bioRxiv - Systems Biology 2024Quote: ... 1-min centrifugation steps at the described speeds (Eppendorf Centrifuge 5810 R) were applied to force liquids through the stationary phase ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Microbiology 2023Quote: ... vortexed for 5 min and then centrifuged (Eppendorf Centrifuge model 5810 R ...
-
bioRxiv - Microbiology 2023Quote: ... centrifuging for 5 min at 7,500 rcf (Eppendorf, tabletop centrifuge MiniSpin plus with rotor F-45-12-11) ...
-
bioRxiv - Biophysics 2021Quote: ... and incubated for 1 hour at 37 °C (incubator Thermomixer C, Eppendorf, Germany). Control samples (no AMPs ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... transferred 1 ml serum to 1.5 ml Eppendorf Tubes® (Eppendorf AG, Hamburg) and stored them at −32° C until assaying ...
-
bioRxiv - Molecular Biology 2022Quote: ... and then incubated for 1 hour with agitation at orbital shaker (Eppendorf, USA) at 55 °C ...
-
bioRxiv - Biophysics 2021Quote: ... diluted 1:10 in 96-well plates (Eppendorf twin.tec® 96; Sigma-Aldrich). Cholesterol measurements were performed in positive ion mode ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1% bromophenol blue) and incubated at 40 °C in a Thermomixer R (Eppendorf) for 0.5 h ...
-
bioRxiv - Immunology 2020Quote: ... a BioSan Vortex V-1 plus and a Table centrifuge (Eppendorf Centrifuge 5424) were also used during the coupling process.
-
bioRxiv - Cancer Biology 2024Quote: ... at a 1:50 ratio in a ThermoMixer C (Eppendorf, Nijmegen, The Netherlands) at 2,000 rpm for 18 hours at 37°C.
-
bioRxiv - Cancer Biology 2024Quote: ... centrifuging the bacteria at 12,000 x G for 1 min (Eppendorf 5430 centrifuge), and resuspended in cold sterile PBS to the desired concentration (either 107 PFU/ 50 μl or 106 PFU/50 μl) ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 ml of bacterial culture was then transferred to sterile cuvettes (Eppendorf). The optical density (OD600 ...
-
bioRxiv - Neuroscience 2023Quote: ... for 1 hour under shaking at 400 rpm using a ThermoMixer C (Eppendorf). Luminescent was read at the Cytation5M reader (BioTek) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1% SDS) for 20 minutes at 70°C in a ThermoMixer F1.5 (Eppendorf). Input samples were brought up to 100 µL in TE with a final concentration of 1% SDS ...
-
bioRxiv - Cell Biology 2020Quote: ... 5000 rpm for 5 min in 5415D centrifuge (Eppendorf) to remove aggregates.
-
bioRxiv - Genomics 2022Quote: ... typically a 5 mL Lo-bind tube (0030122348, Eppendorf) or 15 mL falcon tube (229410 ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were pooled in 5 mL LoBind tubes (Eppendorf) in 1 mL chilled lysis buffer (10 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2024Quote: ... centrifuged at 1200 RPM for 5 minutes (Eppendorf 5180) and stained for cell viability using Fixable Live/Dead Blue for 30 min at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... 20-100% of the 1 mL lysate is purified (96 well vs Eppendorf tubes). 96 well format is eluting in 25ul and utilizing 8.6ul in qPCR ...
-
bioRxiv - Microbiology 2022Quote: ... soil samples for DNA isolation were aliquoted (~1 g into 1.5 ml Eppendorf tubes) and stored immediately at −20 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... Enzymatic digestion proceeded for 1 hr at 37 °C using the ThermoMixer C (Eppendorf) shaking at 400 rpm ...
-
bioRxiv - Immunology 2021Quote: ... 1×106 cells were added to a 1.5 mL low binding tube (Eppendorf, 022431021) and centrifuged (400×g for 5 min at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... 1×106 cells were added to a 1.5 mL low binding tube (Eppendorf, 022431021) and centrifuged (400×g for 5 min at 4°C ...
-
bioRxiv - Biophysics 2023Quote: ... The solutions were centrifuged for 1 minute at 3300g using a MiniSpin centrifuge (Eppendorf) to precipitate impurities interfering with the DLS recording ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1mM EDTA) by heating to 95°C for 1 min in ThermoMixer C (Eppendorf) and cooling down to room temperature ...
-
bioRxiv - Systems Biology 2023Quote: ... Cultivations were carried out in DasGip 1-L stirrer-pro vessels (Eppendorf, Jülich, Germany). The working volume was 500 mL ...
-
bioRxiv - Neuroscience 2024Quote: ... Appropriate volumes containing 1 million cells were transferred to 1.5 ml microcentrifugation tubes (Eppendorf) and centrifuged at 400 g ...
-
bioRxiv - Molecular Biology 2024Quote: ... and they were incubated at 65C for 1 hour in a Thermomixer C (Eppendorf) shaking at 1400 RPM ...
-
bioRxiv - Biochemistry 2024Quote: ... Centrifugation steps were carried out for 1 min (45 x g, room temperature, Eppendorf centrifuge #5804R ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Cell Biology 2023Quote: ... in a 5% CO2 containing humidified incubator (Eppendorf Galaxy 170S) at 37°C.