Labshake search
Citations for Eppendorf :
351 - 400 of 512 citations for 7 ACETOXY 6 METHOXY 3 4 DIHYDROQUINAZODIN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... with incubation on ice for 1 h followed by centrifugation at 4 °C for 20 min at 20,000 g using an Eppendorf Centrifuge 5430R microcentrifuge (Eppendorf Canada Ltd, Mississauga, ON, Canada), supernatant combined and either used same day or stored at –80 °C.
-
bioRxiv - Biochemistry 2023Quote: ... 12,000 rpm was applied for 30 minutes at 4 °C to obtain the supernatant and then evaporated to obtain a dry metabolite pellet (Eppendorf Concentrator plus, Hamburg, Germany). For the NMR experiments ...
-
bioRxiv - Microbiology 2021Quote: ... tubes were centrifuged one minute at 2,500 x g (Eppendorf MiniSpin) before incubation at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... and coinjected into one-cell stage embryos using a microinjector (Eppendorf). Amplification of the target regions for genotyping was performed using primer pairs 5‘-AGGCACGTATCCTCTTCTGG-3‘ and 3‘-CAAGACGACACATCAGCACA-5‘ for exon 1 in inpp5e ...
-
bioRxiv - Immunology 2022Quote: ... Cells were washed with 500μl of D-PBS and centrifuged at 400xg for 10 minutes at room temperature (Eppendorf Centrifuge 5810R, rotor A-4-62). The supernatant was removed and the cell pellet resuspended in 50μl of D-PBS before being stained with CD20-PE (clone A1SB12 ...
-
bioRxiv - Neuroscience 2021Quote: ... were incubated with ten-fold molar excess S-XL6 for 4 hours at 37 °C in protein low bind Eppendorf tubes using Eppendorf Thermomixer at 350 rpm (Eppendorf North America, Enfield, CT, USA). After incubation ...
-
bioRxiv - Biophysics 2021Quote: ... Lipid extracts were resuspended in 60 μl 10mM ammonium acetate in methanol and diluted 1:4 in 96-well plates (Eppendorf twin.tec® 96; Sigma-Aldrich) prior to measurement of PC species ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-liter Bioflo 110 (Eppendorf) were used ...
-
bioRxiv - Microbiology 2021Quote: ... the plates were centrifuged at 1,000 x g for one minute (Eppendorf Centrifuge 5810R with a A-2-DWP-AT plate rotor ...
-
bioRxiv - Microbiology 2020Quote: ... One hundred microliters of sample were loaded into disposable cuvette (Eppendorf 952010077) and analyzed by DLS ...
-
bioRxiv - Genomics 2023Quote: ... One microliter of each cDNA sample was used for TaqMan PCR (Eppendorf RealPlex Mastercycler and Applied Biosystems QuantStudio 3 ...
-
bioRxiv - Biochemistry 2020Quote: Microdissected tissue samples were lysed in SDT buffer (4% SDS, 0.1M DTT, 0.1M Tris/HCl, pH 7.6) in a thermomixer (Eppendorf ThermoMixer® C, 30 min, 95°C, 750 rpm). After that ...
-
bioRxiv - Microbiology 2022Quote: ... Trophozoites were harvested from their growth support by incubating the tubes by tapping the glass tubes followed by centrifugation (Eppendorf centrifuge 5810R, rotor A-4-62) according to a previously reported protocol 84.
-
bioRxiv - Cancer Biology 2023Quote: ... with ø 7 µm collection capillary and separated by piezo-vibrator PiezoXpert (Eppendorf, Germany). Single-cell state hemocytes were individually transferred to 2.3 µl of lysis buffer (38 ...
-
bioRxiv - Neuroscience 2021Quote: ... One single intravitreal injection was carried out using a FemtoJet express microinjector (Eppendorf).
-
bioRxiv - Developmental Biology 2020Quote: ... and transferred to Eppendorf tubes (neural tube tissue from one embryo per Eppendorf) that were snap frozen ...
-
bioRxiv - Neuroscience 2022Quote: ... was injected into one lateral hemisphere of E15.5 embryos using FemtoJet 4i (Eppendorf). Embryonic neural progenitor cells were labelled using the electroporator (ECM 830 ...
-
bioRxiv - Bioengineering 2020Quote: The cjFFs were transfected at P4-6 with Multiporator (Eppendorf) according to the protocol provided by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: ... with an fixed angled-rotor (FA-45-6-30, Eppendorf) and the virus pellet was resuspended in OPC-Sato medium for 1 hour at 4°C on a shaker ...
-
bioRxiv - Cell Biology 2024Quote: ... and denatured at 85°C for 7 minutes using a ThermoMixer® C-PCR 384 (Eppendorf). After denaturation ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Microbiology 2020Quote: ... One milliliter aliquots of each culture were then centrifuged at 15,000 rpm (Eppendorf Centrifuge 5424) for 1 min and the pellets were resuspended in 1 mL 10% marine broth diluted with sterile seawater ...
-
bioRxiv - Neuroscience 2022Quote: ... Later they were put in 2ml Eppendorf in 70% ethanol (60 flies in one Eppendorf). Flies were first crushed in 150ul of 70% ethanol and then 150ul 70% ethanol was added to crush them more ...
-
bioRxiv - Microbiology 2022Quote: ... The tip of one swab was broken off into a 2 ml tube (BioPur, Eppendorf) and snap frozen in dry-ice and stored at −80°C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Microinjection was carried out in medaka embryos at the one-cell stage using FemtoJet (Eppendorf) and InjectMan NI 2 (Eppendorf) ...
-
bioRxiv - Neuroscience 2021Quote: ... starting from 100 ng of total RNA (RIN ≥7) on an epMotion® 5075 TMX workstation (Eppendorf). Library QC included size distribution check (BioAnalyser ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL droplets were inoculated into 6-well plates (Eppendorf, Hamburg, Germany). After allowing the cells to adhere to the surface for 2 hours in a CO2 incubator (37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... for 6 h at 37 °C at 800 rpm (shaking incubator, Eppendorf). After RNAse A was removed by centrifugation ...
-
bioRxiv - Neuroscience 2023Quote: ... 100 microglia were sorted and immediately collected in one well of a 96-well plate (Eppendorf) filled with 5 µl cold lysis buffer from the NEBNext® Single Cell/Low Input cDNA Synthesis & Amplification Module (New England Bio Labs ...
-
bioRxiv - Cell Biology 2023Quote: ... The isolated flagella were pelleted one final time at ∼20000xg (14000rpm in an Eppendorf 5417C centrifuge) for 20 min at 4 C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Organoids were transferred to a 6 cm ultra-low-attachment dish (Eppendorf, 30701011) containing Tyrode’s solution (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... were injected into one of the paired olfactory cavities through fine glass capillaries using a pressurized (Eppendorf FemtoJet Express ...
-
bioRxiv - Molecular Biology 2022Quote: One ml of SF per sample was spun in a benchtop centrifuge (Eppendorf non-refrigerated centrifuge 5420) at rpm1400rpm for 10 min ...
-
bioRxiv - Developmental Biology 2019Quote: ... was injected at a concentration of 40 mM in embryos either at the end of cellularization around 5 min before imaging or at stage 7 during imaging using an InjectMan4 micromanipulator and a FemtoJet 4i microinjector from Eppendorf directly installed on the imaging microscope.
-
bioRxiv - Cell Biology 2020Quote: ... or western blot analysis (200 000 cells in 6-well plates (Eppendorf, cat# 0030720113) were left to attach for 48h ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then seeded in a Matrigel-coated 6-well plate (Eppendorf, cat # 0030720113) to 2.5×106 cells/well with dual SMAD inhibitor media supplemented with Dorsomorphin (1μM ...
-
bioRxiv - Developmental Biology 2019Quote: ... We have determined that one critical parameter in this process is the use of low-retention 1.5 ml microcentrifuge tubes (e.g., Eppendorf DNA LoBind tubes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The mixture was incubated at 25 °C and 1,500 rpm for one hour by using a ThermoMixer (Eppendorf), and then centrifuged at 14,000 rpm for 10 min ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Genomics 2019Quote: ... One µl of this cocktail was added to the PCR mixture and placed in a thermocycler (Eppendorf MasterCycler Pro). Thermocycling settings were as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... One milliliter of the supernatant was then transferred to new tubes after centrifugation at 14,000 rpm (Eppendorf K-5418R). A total of 1.2 mL of a 10 mM sodium periodate solution (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... Injections were performed in less than one-day-old female pupae using a microinjector (Fentojet® Express, Eppendorf®) and a micromanipulator (Narishige®) ...
-
bioRxiv - Bioengineering 2019Quote: ... centrifuging for 5 min at 400 rcf (RT, Eppendorf 5430; Rotor: F-35-6-30), re-suspension in fresh medium and transfer to cultivation flask.
-
bioRxiv - Biochemistry 2021Quote: ... cells were seeded into 6-well or 12-well polystyrene coated plates (Eppendorf; EP0030720130, EP0030721012) at a density of 0.3 x 106 cells mL−1 or 0.1 x 106 cells mL−1 ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were kept soaked at 37 °C for up to 7 days on an orbital shaker (Excella E24, Eppendorf, Hamburg, Germany) with an agitation rate of 150 rpm ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfected cells were transferred into 8.0 mL of MA2 media in 20 mL culture tubes and allowed to recover while rotating (∼80 rpm) in the outer rim of a tissue culture roller drum (New Brunswick; model TC-7; Eppendorf, USA) housed in an Algatron® incubator (Photon Systems Instruments ...
-
bioRxiv - Biophysics 2023Quote: ... The blood was centrifuged at 250 RCF (relative centrifugal force) and 7 rad/s2 acceleration for 20 min (5810 R, Eppendorf, Hamburg, Germany). The platelet rich plasma (PRP ...
-
bioRxiv - Cell Biology 2021Quote: ... Frozen cell pellets were resuspended in hypotonic buffer and homogenized using a disposable plastic pestle (As One Corp., Osaka, Japan) with matched Safe-Lock tubes (Eppendorf). The detailed procedure is summarized in Fig ...
-
bioRxiv - Genomics 2021Quote: ... live cell was index-sorted into one 96-well quadrant of a 384-well plate (Eppendorf lo-bind twin-tec) containing a mixture of DPBS and shearing master mix at a final volume of 2.14 μL using a MoFlo Astrios cell sorter running Summit v6.3 (Beckman Coulter) ...
-
bioRxiv - Bioengineering 2019Quote: ... One hundred nanograms of cDNA were amplified in duplicates in each 40-cycle reaction using a Mastercycler (Eppendorf, Hauppauge, NY) with annealing temperature set at 60°C ...